ID: 977676776

View in Genome Browser
Species Human (GRCh38)
Location 4:99756882-99756904
Sequence AGTCACACAAACAGAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977676776_977676782 22 Left 977676776 4:99756882-99756904 CCCAGGTTTCTGTTTGTGTGACT No data
Right 977676782 4:99756927-99756949 CTCAGATGAAAAAAGAGAAAAGG No data
977676776_977676780 -10 Left 977676776 4:99756882-99756904 CCCAGGTTTCTGTTTGTGTGACT No data
Right 977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977676776 Original CRISPR AGTCACACAAACAGAAACCT GGG (reversed) Intergenic
No off target data available for this crispr