ID: 977676780

View in Genome Browser
Species Human (GRCh38)
Location 4:99756895-99756917
Sequence TTGTGTGACTAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977676774_977676780 28 Left 977676774 4:99756844-99756866 CCGGGGGCTGGTTCTCAGTGGAG No data
Right 977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG No data
977676776_977676780 -10 Left 977676776 4:99756882-99756904 CCCAGGTTTCTGTTTGTGTGACT No data
Right 977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977676780 Original CRISPR TTGTGTGACTAGAGGGAAGC TGG Intergenic
No off target data available for this crispr