ID: 977684940

View in Genome Browser
Species Human (GRCh38)
Location 4:99836941-99836963
Sequence GTTCTACGGCAGCAAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977684940_977684949 14 Left 977684940 4:99836941-99836963 CCATTCCCTTGCTGCCGTAGAAC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 977684949 4:99836978-99837000 TCCTTTTAGCTGTCAGCCAGGGG No data
977684940_977684947 12 Left 977684940 4:99836941-99836963 CCATTCCCTTGCTGCCGTAGAAC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 977684947 4:99836976-99836998 TTTCCTTTTAGCTGTCAGCCAGG 0: 1
1: 0
2: 9
3: 38
4: 325
977684940_977684948 13 Left 977684940 4:99836941-99836963 CCATTCCCTTGCTGCCGTAGAAC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 977684948 4:99836977-99836999 TTCCTTTTAGCTGTCAGCCAGGG 0: 1
1: 0
2: 5
3: 34
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977684940 Original CRISPR GTTCTACGGCAGCAAGGGAA TGG (reversed) Intronic
901801005 1:11707959-11707981 GTTCTTTGGCAGGAAGGCAATGG + Intronic
903587477 1:24427147-24427169 GTTCTGCTGCAGGGAGGGAATGG - Intronic
903917350 1:26774128-26774150 TTTCTACTTAAGCAAGGGAAGGG + Intronic
907803890 1:57799222-57799244 GTTATAGAGCAGCTAGGGAAGGG + Intronic
908356545 1:63329018-63329040 GTTGGAGGGCAGCAAGGGGAGGG - Intergenic
909102043 1:71359886-71359908 GTTCTATGGCTGGAAGGAAAAGG - Intergenic
909583793 1:77266680-77266702 GTTCTGGGGCAGTCAGGGAAAGG + Intergenic
912552608 1:110494015-110494037 GTTCTAGGCCAGCTAGGGGAGGG - Intergenic
917677547 1:177334131-177334153 GTTTTTTGGCTGCAAGGGAAAGG + Intergenic
923369929 1:233299656-233299678 GTGGTACGACAGAAAGGGAATGG + Intergenic
1069997894 10:72354301-72354323 GTTCTTCGGGCGCCAGGGAAAGG - Intronic
1071177701 10:82945539-82945561 GTTCTATGGCAGAAGGGGGAAGG + Intronic
1077091571 11:780699-780721 GTGCAAAGGCTGCAAGGGAAAGG - Intronic
1078900173 11:15634700-15634722 GTCCTGCGGCAGCCAGGGAATGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089023071 11:115238428-115238450 CTTTTACAGCAGCAAGGAAAAGG - Intronic
1097726952 12:63086420-63086442 GGTCTATAGCAGCAAGGGATTGG - Intergenic
1100147036 12:91690842-91690864 GTTCTACGGCAGTATGTGATTGG + Intergenic
1101064218 12:101002514-101002536 GTGCTCCTGCAGCATGGGAATGG + Intronic
1101839972 12:108321062-108321084 GCTCTGCGGCAGCCAGGGAGAGG - Intronic
1107981876 13:45741790-45741812 CATCAACGGCAGGAAGGGAAGGG + Intergenic
1115114227 14:29860284-29860306 GTTCTATTGCAGCAAGCAAATGG + Intronic
1115960671 14:38833798-38833820 GTTCTACGGAAAGAAAGGAATGG - Intergenic
1117023705 14:51598282-51598304 GTGCTTCTGCAGGAAGGGAATGG - Intronic
1119653236 14:76398454-76398476 GTTCAAAGGCAGCTAGGAAATGG + Intronic
1120831555 14:89001690-89001712 GTTCTATGGCTCCAAGGGAAGGG - Intergenic
1122855286 14:104557026-104557048 GTTCTGGGGCAACTAGGGAAGGG - Intronic
1125695581 15:41634599-41634621 GTTCTACCTCAGTAAGGGGAAGG - Intronic
1126841288 15:52719774-52719796 GTTCTACGGCCAGAAAGGAAGGG - Intergenic
1130145705 15:81272338-81272360 GGTCTACAGCAGGAAGAGAAGGG - Intronic
1135335685 16:21599524-21599546 GTTCCGCGGCCGGAAGGGAAGGG + Exonic
1139355009 16:66362351-66362373 GTTCTGCGCCAGCCTGGGAATGG - Intergenic
1141869037 16:86772021-86772043 TTTCAACGGCAGGAAGGGAATGG + Intergenic
1147910356 17:43852595-43852617 GTTCTAAGGCAGAGAGGGATGGG + Intronic
1150936042 17:69636839-69636861 GTCCTACAGCAGCAAGGGACTGG - Intergenic
1152604622 17:81282931-81282953 GCTCCCCGGCAGCGAGGGAAAGG + Intronic
1157066368 18:44355599-44355621 TTTCTAGGGCAGCCAGAGAAAGG - Intergenic
1159531968 18:69666355-69666377 GTGCTCAGTCAGCAAGGGAAAGG - Intronic
1165635816 19:37339025-37339047 GTTGTATGGCACCAAGGAAAAGG - Intronic
1165800435 19:38546282-38546304 GTTCCTCGGAAGCAGGGGAAGGG - Intronic
1165866138 19:38940365-38940387 GTTTTACAGCACCAAAGGAAGGG + Intronic
1165912726 19:39239006-39239028 GCTCTAAGGCAGCCAGAGAAGGG + Intergenic
1166583516 19:43924954-43924976 GGTCCACAGCAGCAAGGGAGGGG - Intronic
925342140 2:3145219-3145241 GTTCTACAGGATCAAGGGAAAGG - Intergenic
925531421 2:4867344-4867366 GGTGTAGGGCGGCAAGGGAAGGG + Intergenic
926690284 2:15728507-15728529 ATTCTACTGCAGAAAGGGGAAGG - Intronic
927852066 2:26505704-26505726 GTCCTACGGCATCGAGGCAAAGG - Intronic
931567511 2:63629786-63629808 GTGCTACGGCAGGAAGGGTGGGG - Intronic
935042808 2:99449692-99449714 GTTGTCTGGCAGCCAGGGAAGGG - Intronic
935903892 2:107822585-107822607 GTTCTACCCCAGGAAGAGAAGGG + Intergenic
936294457 2:111256260-111256282 GTTGGACAGCAGCAGGGGAAGGG - Intergenic
940169585 2:150813523-150813545 TTTCTACGGAGGCAGGGGAATGG + Intergenic
942456407 2:176141119-176141141 GTTCTAAGTGAGCAAGGGCAAGG - Intergenic
944177679 2:196850968-196850990 GTTCAACTCCAGCAAGGGGATGG + Intronic
946125636 2:217560193-217560215 ATCCTAGGGCAGCAAGAGAAGGG + Intronic
948035805 2:234857532-234857554 GTTCTCAGGGAGCAAGGGGAGGG + Intergenic
1175343925 20:58256579-58256601 GTTCTTCTGCATTAAGGGAAAGG + Intergenic
1179723580 21:43329673-43329695 GTGCTACACCAGAAAGGGAAGGG - Intergenic
1180238442 21:46480649-46480671 GTTCTTTGGCAGCAAGGGAAAGG + Intronic
1184741159 22:46429824-46429846 GTCCTAGAGCATCAAGGGAAAGG - Intronic
951030955 3:17881324-17881346 GTTCCAGGGCAGCAAAGGTAGGG + Intronic
974903510 4:68031113-68031135 GTTCTCCGGCAGACAGGGGAGGG - Intergenic
975122342 4:70742583-70742605 GTTCTGCAGCAGCAAGTGAATGG - Intronic
977684940 4:99836941-99836963 GTTCTACGGCAGCAAGGGAATGG - Intronic
979657268 4:123209803-123209825 GTTCTAGGGCAGGGAGGGAGAGG - Intronic
981870166 4:149476200-149476222 CATCTATGGCAGCAAGAGAAAGG + Intergenic
983533971 4:168838140-168838162 CTTCTACTGCAGCAAGTGACTGG + Intronic
995775144 5:115717094-115717116 GTCCTACAGCTGCAAGGCAATGG - Intergenic
999197642 5:149793307-149793329 GTTCTCCTGCAGGAAGGGAGAGG + Intronic
1000198019 5:158978485-158978507 CCTTTAAGGCAGCAAGGGAAAGG + Intronic
1005424633 6:25689477-25689499 GTTCTACTGAAGAAAGGAAAAGG + Exonic
1006068259 6:31478045-31478067 GTTCTGGGGCATCAGGGGAATGG + Intergenic
1011498523 6:87962629-87962651 CTTCAAAGGCAGCAATGGAAAGG - Intergenic
1017416971 6:154231112-154231134 GTTCTAAGGCGGCATGAGAATGG - Intronic
1019434984 7:1017888-1017910 TTCCTACCGCAGCATGGGAAAGG - Intronic
1022676831 7:32509125-32509147 CTTCCACGCCAGAAAGGGAAAGG - Intronic
1023028453 7:36072954-36072976 GTTCATCAACAGCAAGGGAATGG - Intergenic
1023133945 7:37032257-37032279 CATCTAAGGGAGCAAGGGAAAGG + Intronic
1031977014 7:128100543-128100565 GTTCCACGCCAGCAAGGTGAAGG - Intergenic
1032785767 7:135198136-135198158 CCTCTAGGGCACCAAGGGAAAGG - Exonic
1037628257 8:20627688-20627710 TTTCCATGGCAGCAGGGGAAAGG + Intergenic
1039542446 8:38382765-38382787 GTCCTACGGCTGTCAGGGAAGGG + Intergenic
1041640073 8:60188734-60188756 ATTCTTGGGCAGCAAGAGAAAGG - Exonic
1044188050 8:89280189-89280211 ATTCTACTGCAGCAAGAAAAAGG + Intergenic
1046025059 8:108712469-108712491 GTGCTAGAGCAGCATGGGAAGGG - Intronic
1048606438 8:135973483-135973505 ATCCCAGGGCAGCAAGGGAAAGG + Intergenic
1055235176 9:74113362-74113384 GTTCTATGGCATCAGTGGAAGGG - Intergenic
1055710724 9:79058796-79058818 GTTCTTCTGCAGCTTGGGAAGGG - Intergenic
1056328289 9:85500444-85500466 GTACTCCTGCAGCAAGAGAATGG + Intergenic
1056767828 9:89455542-89455564 CTTCCCCGGCAGGAAGGGAAGGG - Intronic
1060025511 9:120167595-120167617 CTTCCAGGGCAGCAAGTGAATGG + Intergenic
1194066460 X:89267603-89267625 GTTCTCCTCCAGCAAGGGAGAGG + Intergenic
1194946299 X:100072466-100072488 ATTCTATTGCAGCAAGAGAAAGG - Intergenic
1200720629 Y:6601724-6601746 GTTCTCCTCCAGCAAGGGAGAGG + Intergenic