ID: 977685073

View in Genome Browser
Species Human (GRCh38)
Location 4:99838087-99838109
Sequence CTACGTGGCTGGCAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977685066_977685073 -5 Left 977685066 4:99838069-99838091 CCATCACTCGTTTTCTTGCTACG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 977685073 4:99838087-99838109 CTACGTGGCTGGCAGGGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 327
977685065_977685073 -4 Left 977685065 4:99838068-99838090 CCCATCACTCGTTTTCTTGCTAC 0: 1
1: 0
2: 0
3: 3
4: 104
Right 977685073 4:99838087-99838109 CTACGTGGCTGGCAGGGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977685073 Original CRISPR CTACGTGGCTGGCAGGGGGA TGG Intronic
900565783 1:3331241-3331263 CCCCCAGGCTGGCAGGGGGAAGG - Intronic
900680061 1:3911720-3911742 CAACGTGCCTGGAAGGAGGAAGG - Intergenic
901016427 1:6234558-6234580 CTCGGTGGCGGGCAGGGGCAGGG - Intronic
901452513 1:9344740-9344762 CTACGTGACAGTCAGGGGGCCGG - Intronic
901643537 1:10704974-10704996 CTAAGAGGCTGGCAGGGAGAAGG - Intronic
902876639 1:19344495-19344517 CTGCAGGGCTGGCAGGTGGAGGG - Intronic
903171049 1:21554013-21554035 CGACGTGGGTGGGAGGGGGTGGG - Exonic
903652993 1:24932422-24932444 CTCCGCGGCTGGCAGGGCGCGGG - Intronic
904028403 1:27519331-27519353 CAACAGGCCTGGCAGGGGGATGG - Intergenic
904038836 1:27572782-27572804 CAAGGAGGCTGGCAGTGGGAGGG - Intronic
904713255 1:32447731-32447753 ATAAGTGGCTGGCAGAGGCAGGG - Intergenic
905062021 1:35148386-35148408 ATAAGTGGCTGGCAGAGGCAAGG - Intergenic
905278338 1:36833456-36833478 CAACCTGGCTGGTCGGGGGAGGG + Intronic
905708587 1:40081423-40081445 CTACTTGGGAGGCAGAGGGAGGG + Intronic
906508489 1:46397259-46397281 CCACCTGGCTGGCAGGGGTGTGG + Intronic
906805327 1:48775166-48775188 CTAGGTGTCTGGCAGTGGGTGGG + Intronic
907254275 1:53166580-53166602 CTACGTGGCATGCAGTGGGTGGG + Intergenic
907793598 1:57692341-57692363 ATAAGTGGCTGGCAGAGGCAGGG + Intronic
908015892 1:59835716-59835738 CGGGGTGGCGGGCAGGGGGAAGG + Intronic
908809504 1:67965345-67965367 CTTCATGTCTGGCAGGGAGAAGG - Intergenic
910439521 1:87238352-87238374 CTAGTTGGCTGGTAGGTGGACGG + Intergenic
915261021 1:154676900-154676922 ATAAGTGGCTGGCAGAGGTAGGG + Intergenic
916084099 1:161255817-161255839 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
916133635 1:161632427-161632449 CTCTGTGTGTGGCAGGGGGAGGG - Intronic
917372305 1:174307471-174307493 ATTAGTGGCTGCCAGGGGGAAGG - Intronic
917964211 1:180168249-180168271 CTGCCTGGCTGGCTGTGGGAGGG + Intronic
918373739 1:183887610-183887632 ATTCTTGGCTGGCATGGGGAAGG - Intronic
919206703 1:194427425-194427447 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
919257219 1:195140195-195140217 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
920960739 1:210661835-210661857 GCAGGTGGGTGGCAGGGGGAGGG + Intronic
922461385 1:225816754-225816776 CTACATGGCTGGCAGGCAGCAGG + Intronic
922514537 1:226197201-226197223 TTATGGGGCTGGCAGAGGGATGG + Intergenic
923823268 1:237471152-237471174 ACACGTGGCTGGCAAGGAGACGG + Intronic
1063415117 10:5866723-5866745 GTAAGTGGCTGGCAGAGGCAGGG + Intronic
1064603130 10:17013469-17013491 ATAAGTGGCTGGCAGAGGCAGGG - Intronic
1064674742 10:17749757-17749779 CTAATTGTCTGGCAGTGGGAGGG + Intergenic
1067693132 10:48517347-48517369 CTACATAGCTGGCTGGGGGTGGG + Intronic
1067963296 10:50880794-50880816 CTACCTGCCTGGCAGGGGACTGG - Intronic
1069111821 10:64456767-64456789 CTACTATGCTGGCAGGGGGGAGG - Intergenic
1070577159 10:77687827-77687849 CCAGGTGGATGGCAGGGGGCAGG - Intergenic
1072334554 10:94385803-94385825 ATAAGTGGCTGGCAGAGGCAAGG + Intergenic
1073037344 10:100573277-100573299 CTGTGTGGCGGGCATGGGGAGGG + Intergenic
1073177569 10:101565722-101565744 CTGCATGGCTGGCTGGGGGGTGG - Intergenic
1074613229 10:115040679-115040701 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
1075515905 10:123108040-123108062 TTACATGGCGGGAAGGGGGAGGG - Intergenic
1075606646 10:123816322-123816344 CTCCCTGGCTGGTAGGGTGAGGG + Intronic
1075782677 10:125027078-125027100 CCACCTGTCTGGCAGGGGCAGGG + Exonic
1076373845 10:129970913-129970935 CGCCGGGGCTGGAAGGGGGAGGG + Intergenic
1076690040 10:132219021-132219043 CTTCGTGGCTGCCAGGGGAGGGG + Intronic
1076742851 10:132496529-132496551 CTACGTGCCAGCCAAGGGGAAGG - Intergenic
1077213516 11:1384345-1384367 GTGGGTGGGTGGCAGGGGGAGGG - Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1078333427 11:10444903-10444925 CTAAGTGCATGGCAGGGGGCTGG - Intronic
1081614379 11:44581872-44581894 CTTCATGGCTGGCTGGTGGAGGG + Intronic
1082786778 11:57321746-57321768 CCAGGTGGCTGGGAGGGGGGTGG - Intronic
1082999478 11:59278449-59278471 CTCCGTGACTGGTAGGGTGAGGG + Intergenic
1083198219 11:61103435-61103457 CTTCCAGGCTGGCAGGGAGAGGG + Intronic
1084654191 11:70505696-70505718 GTACGAGACTGGCACGGGGATGG + Intronic
1084708654 11:70830461-70830483 CTCCGTGGCTTGGAGGGTGAAGG - Intronic
1085632314 11:78128719-78128741 CTACTTGGGTGGCTGGGGCAGGG - Intronic
1086973639 11:93109543-93109565 ATAAGTGGCTGGCAGAGGCAAGG - Intergenic
1087070236 11:94072432-94072454 CTACGTGGCTGCAAGAGTGATGG + Intronic
1089023313 11:115241086-115241108 CTAAATGGCTGGCAGGGGGTGGG - Intronic
1090276651 11:125424740-125424762 CTACATGGCTAGGAGGTGGAAGG + Intronic
1090524572 11:127518688-127518710 CTATGTGTGTGGCAGGGGAAAGG - Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091583214 12:1801004-1801026 CTGGCTGGCTGGCAGAGGGAAGG + Intronic
1094072268 12:26430883-26430905 CTACTTGGGAGGCAGAGGGATGG - Intronic
1094072548 12:26433795-26433817 CTACTTGGGAGGCAGAGGGATGG + Intronic
1096207549 12:49735537-49735559 ATAAGTGGCTGGCAGAGGCAAGG + Intronic
1097323459 12:58250259-58250281 CTCCATGGATGGCAAGGGGAAGG - Intergenic
1097428495 12:59474482-59474504 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
1097437903 12:59572622-59572644 CTCCCTGACTGGTAGGGGGAGGG + Intergenic
1098534185 12:71576082-71576104 CTATCAGGGTGGCAGGGGGAGGG + Intronic
1098749706 12:74278414-74278436 CTCCCTGACTGGCAGGGTGAGGG + Intergenic
1099104050 12:78478566-78478588 ATACTTGGGTGGCAGGGGCAAGG - Intergenic
1103535875 12:121633491-121633513 CCCCTTGGGTGGCAGGGGGAGGG - Intronic
1104038271 12:125113529-125113551 CTGTGTGTCTGGCAGGGGCAGGG - Intronic
1104970473 12:132528505-132528527 CCCCGTGGCGGGCAGGGGGAAGG + Intronic
1106447697 13:29850744-29850766 CTACGAGGGTGGGGGGGGGAGGG + Intergenic
1107151099 13:37112643-37112665 ATGCATGGCTGGCAGGGGGTAGG - Intergenic
1107624870 13:42272104-42272126 CCGCGGGGCTGGGAGGGGGAGGG + Intergenic
1107983717 13:45757075-45757097 CTTCCTGACTGGTAGGGGGAGGG - Intergenic
1108849045 13:54705648-54705670 ATAAGTGGCTGGCAGAGGTAGGG + Intergenic
1110011456 13:70339746-70339768 ATACGTGGCTGGCAAAGGGAAGG - Intergenic
1112346421 13:98593750-98593772 TTATGGGGCTGGCAGGAGGAGGG - Intergenic
1114031263 14:18583148-18583170 CGCCGGCGCTGGCAGGGGGAGGG - Intergenic
1116904284 14:50390117-50390139 CTATGTGGCAGGTAGGGGCAAGG - Intronic
1117352616 14:54896359-54896381 CAACCTGGATGGCAGGGAGAAGG - Intronic
1124377324 15:29136362-29136384 TCACCTGGCTGGCAGGGGGCTGG + Exonic
1127647672 15:60974434-60974456 CTACCTGGCTGGCTGTGTGAAGG - Intronic
1129252054 15:74314573-74314595 CTAGGGGGCTGGCAGGGGGAGGG - Intronic
1129939058 15:79478127-79478149 CCACGTGGATGGCAGGAGGCTGG - Intergenic
1130979481 15:88803155-88803177 CTCCGGGGCTGGCGGGAGGAAGG - Intergenic
1131070598 15:89463311-89463333 CTGCCTGCCTGGAAGGGGGAAGG + Intergenic
1132748227 16:1445725-1445747 CTTGGTGGCTGGCAGGGGCGGGG + Exonic
1133478753 16:6148884-6148906 TTACGTGGCAGGGAGGGGGGTGG - Intronic
1134081671 16:11328959-11328981 TTAGGTGGGAGGCAGGGGGATGG - Intronic
1134091425 16:11393552-11393574 CCACGAAGCTGGGAGGGGGAAGG + Exonic
1134386645 16:13779736-13779758 CCACGTGGCTGGCAAAGAGAAGG - Intergenic
1135339210 16:21632041-21632063 ATAAGTGGCTGGCAGAGGCAGGG - Intronic
1137001652 16:35234852-35234874 CTGGGTGGCTGGCTGGGGGTGGG - Intergenic
1137441692 16:48503803-48503825 CTGAGAGGCTGGCAGGGGGATGG + Intergenic
1138212274 16:55173597-55173619 ATAGGTGGCTGGCCGGGGGAAGG + Intergenic
1138299149 16:55911890-55911912 CTATGGGGCTGCCAGGGAGAGGG + Intronic
1138625047 16:58244863-58244885 CTAAGTGGGAGGCAGGGGCAAGG - Intronic
1139576449 16:67845416-67845438 GTAGGTGGCTGGTTGGGGGATGG + Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140046264 16:71442081-71442103 TTCGGTGGCTGGCAGGGGGTGGG + Intergenic
1141158676 16:81614281-81614303 CTAGGTGGCTGGAAGCGGCACGG + Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1143610410 17:8014761-8014783 CTCCGTGGGTGCCAGTGGGAAGG + Exonic
1143671186 17:8397294-8397316 CCACCTGGGAGGCAGGGGGAAGG + Intronic
1144573538 17:16415504-16415526 CTTAGTGGCTAGAAGGGGGAGGG + Intergenic
1145780528 17:27560060-27560082 CCACGTGGCTGGAGGGTGGAAGG + Intronic
1146677652 17:34784629-34784651 CTGGGGTGCTGGCAGGGGGAAGG - Intergenic
1147810451 17:43166275-43166297 ATAAGTGGCTGGCAGAGGCAAGG - Intergenic
1148209546 17:45799968-45799990 GGACGTGGCTGTCAGAGGGAGGG - Intronic
1148214145 17:45825292-45825314 ATGCATGGCTGGCCGGGGGATGG + Intronic
1148487450 17:47999916-47999938 CTCAGTGGGTGGCAGGAGGATGG + Intergenic
1148830156 17:50426042-50426064 CTTCGAGGGTGGGAGGGGGAGGG + Intergenic
1151163253 17:72183506-72183528 CTCCCTCGCTAGCAGGGGGATGG - Intergenic
1151213678 17:72562946-72562968 CTTAGTGGCTGGCAGGGGCTGGG - Intergenic
1151802211 17:76385146-76385168 CCTCGGGGCTGCCAGGGGGAGGG - Exonic
1152453501 17:80398641-80398663 ATAAGTGGCTGGCAGAGGCAAGG + Exonic
1153791929 18:8586614-8586636 CTTCGTGGGTGGCTGGAGGAGGG + Intergenic
1155112921 18:22734413-22734435 CCGCCTGGCTGGCAGGGGGTAGG - Intergenic
1156716408 18:40017570-40017592 ATAAGTTGCTGGCAGGGGAATGG + Intergenic
1161337420 19:3721921-3721943 CTCCAAGGGTGGCAGGGGGAGGG + Intronic
1161830389 19:6598483-6598505 ATAAGTGGCTGGCAGAGGCAAGG + Intronic
1162911042 19:13847846-13847868 CTGCGCCGCCGGCAGGGGGAGGG - Intergenic
1163822716 19:19505446-19505468 CCACGTGGCTGACTGGGGGATGG - Exonic
1164771574 19:30813638-30813660 CTAGAAGGCTGGCAGGGGGCAGG + Intergenic
1165359412 19:35326727-35326749 CTCCCTGGCTGGGAGTGGGAGGG + Intronic
1165361849 19:35341679-35341701 CTGCATGGCGGGCAGGGGGAGGG - Intronic
1166798950 19:45444269-45444291 CGAAGCGGCTGGCTGGGGGAGGG - Intronic
1167173773 19:47851420-47851442 CTACTTGGGTGGCTGAGGGAGGG - Intergenic
1167201536 19:48068831-48068853 CTCCATGGCTTGCAGAGGGATGG - Intronic
1167380580 19:49135854-49135876 CTATGTGGCTGGCAGTGGTCGGG + Exonic
1168313522 19:55473488-55473510 TTACCTGGCTGGCAGGGGGCAGG + Intergenic
925131663 2:1498009-1498031 AAAAGTGGCTGGGAGGGGGATGG + Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926321053 2:11748666-11748688 AGAGGTGGCAGGCAGGGGGAGGG - Intronic
926423972 2:12724719-12724741 ATATGAGGCTGGTAGGGGGAGGG - Intronic
926953896 2:18272340-18272362 CTGGGTGGCTGGCTAGGGGATGG + Intronic
927641730 2:24849795-24849817 CTTGGGGGGTGGCAGGGGGAGGG - Intronic
928452563 2:31389432-31389454 CAAGGTGGCTGGCTGGGGGGAGG - Intronic
928804630 2:35135488-35135510 ATTCGTGGCTGTCAGGGGGCTGG - Intergenic
929093346 2:38241024-38241046 CTAAGTAGCTGGCAGAGGGAGGG + Intergenic
929330680 2:40676630-40676652 TTAAGTGGCTGGCAGAGGCAGGG + Intergenic
929861850 2:45684865-45684887 CTGTGTGGCTGGCAGGGGGCTGG + Intronic
929873558 2:45777776-45777798 CCAAGTTTCTGGCAGGGGGAAGG - Intronic
930602809 2:53461245-53461267 ATCCGTGGCTGGCTGGTGGAAGG - Intergenic
932239033 2:70142673-70142695 CTGCGTGGCTCGCAGGGGCGGGG - Intergenic
935183790 2:100713661-100713683 CTCCGTGACTGGTAGGGTGAGGG + Intergenic
935721635 2:105985010-105985032 ATAAGTGGCTGGCAGAGGCAAGG - Intergenic
937057488 2:118951994-118952016 ATAAGTGGCTGGCAGAGGCAGGG - Intronic
938208956 2:129448628-129448650 TTATGTCTCTGGCAGGGGGATGG + Intergenic
938291820 2:130154634-130154656 GTAGGTGGCTGACATGGGGAGGG + Intronic
938301732 2:130219342-130219364 CCAAGTGGCTGGGAGAGGGAAGG - Intergenic
938454968 2:131455109-131455131 CCAAGTGGCTGGGAGAGGGAAGG + Intergenic
938464728 2:131518330-131518352 GTAGGTGGCTGACATGGGGAGGG - Intergenic
939495921 2:142928550-142928572 CAACGTGGCTGGAAGGGAAATGG + Intronic
940009260 2:149037904-149037926 CTGCCTGGCTGGCAGTGGGTGGG + Intergenic
943102887 2:183509350-183509372 ATAAGTGGCTGGCAGAGGCAGGG - Intergenic
945798755 2:214397987-214398009 TCATGTGGCTGGCAGGCGGAAGG - Intronic
946187695 2:217990480-217990502 GTATGTGGCTGGCATGTGGATGG - Intronic
946830578 2:223724263-223724285 ACACGTGGCTGGCAAAGGGAAGG + Intergenic
947165939 2:227262274-227262296 TTAGGGGCCTGGCAGGGGGAAGG - Intronic
947556545 2:231098596-231098618 ATAAGTGGCTGGCAGAGGCAGGG - Intronic
947909011 2:233789653-233789675 CTCCTGGGCTGGCAGAGGGAAGG - Intronic
948174466 2:235932212-235932234 CTGCCTGGCTGGCAGGTGGCGGG - Intronic
1170401118 20:15984878-15984900 ATAAGTGGCTGGCAGAGGCAAGG - Intronic
1170693595 20:18637278-18637300 CTGCCTGTGTGGCAGGGGGAAGG - Intronic
1171423835 20:25037194-25037216 CTAGGTGGATGCCAGGAGGAAGG - Intronic
1172340841 20:34156099-34156121 ATAAGTGGCTGGCAGGGGCAGGG + Intergenic
1172799756 20:37567551-37567573 CTACATGGCTCGTAGGAGGAAGG - Intergenic
1173051016 20:39561821-39561843 CTGCGTTGCAGGCAGGAGGAAGG + Intergenic
1173558476 20:43984896-43984918 GGAGGTGGCTGGGAGGGGGAAGG - Intronic
1173621627 20:44441352-44441374 GTATGTGGCTGCCAGGGGCAAGG + Intergenic
1174019706 20:47520360-47520382 ATAAGTGGCTGGCAGAGGCAGGG - Intronic
1174270667 20:49365957-49365979 CTCCTTGGCTGGCCTGGGGAAGG + Exonic
1174733886 20:52945494-52945516 TTTCGTGGCTGCCAGAGGGATGG + Intergenic
1175820159 20:61904717-61904739 CCACGTGGGAGGCAGTGGGAGGG - Intronic
1175868471 20:62194704-62194726 CTGGGTGGCTGTCAGGGGCAGGG + Intronic
1176098562 20:63354824-63354846 CTGGGTGGCTTGCAGGGGGCAGG + Intronic
1177991204 21:28038270-28038292 CTTCCTGACTGGCAGGGTGAGGG - Intergenic
1178015619 21:28343093-28343115 CTGCATGGCTGGCAGCGGGGTGG + Intergenic
1180455376 22:15510206-15510228 CGCCGGCGCTGGCAGGGGGAGGG - Intergenic
1181021842 22:20107641-20107663 CTATGTGGCTTGTAGGGAGATGG + Intronic
1181868243 22:25876339-25876361 CTATGTGGCAGGCAGGGTGCTGG + Intronic
1181999864 22:26911508-26911530 CACCATGGCTGGCAGGTGGATGG - Intergenic
1183948143 22:41338421-41338443 CTACAGGGCTGGGATGGGGAGGG - Intronic
1184376620 22:44117461-44117483 CGAGGTGGCTGGCAGGGGGAGGG - Intronic
1184500438 22:44868299-44868321 CCAGGTGGGGGGCAGGGGGACGG + Intergenic
1184556508 22:45236104-45236126 CCACGTAGCTGGCAGGTGGCAGG - Intronic
1184600473 22:45540415-45540437 GGACTTGGCTGGCAGGGAGAGGG + Intronic
950110356 3:10414724-10414746 CGATGTGGCTGGAAGGGTGAGGG + Intronic
951020918 3:17779815-17779837 ATAAGTGGCTGGCAGAGGCAGGG + Intronic
953434047 3:42864721-42864743 TTACGTGCCTCGCAGGCGGATGG + Exonic
953461511 3:43085066-43085088 CATCGTGGCTGGGAGGGGGAGGG + Intronic
953493968 3:43371002-43371024 CTACAAGGCTGGGAGGGAGAAGG - Intronic
953610432 3:44443184-44443206 CTGGGGGGCTGGCATGGGGAAGG + Exonic
954031095 3:47820419-47820441 CCACTTGGCTGGCAAGGAGACGG - Intronic
954434895 3:50490775-50490797 CTATGTGGCTGGGAGGGGTGGGG - Intronic
954599226 3:51854637-51854659 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
956413124 3:68999216-68999238 CTATGTGCCTGGCACTGGGATGG - Intronic
956440321 3:69274398-69274420 CTCCGTAGCTGGCAGGGGGCTGG + Intronic
957233910 3:77559373-77559395 CTACATGGCAGGTAGGAGGAAGG - Intronic
959423897 3:106161617-106161639 TTATGTGTGTGGCAGGGGGAGGG + Intergenic
960292005 3:115897147-115897169 GTATGTGTGTGGCAGGGGGAGGG + Intronic
960829971 3:121835500-121835522 CTACGGGGCGGGGAGGGGGGAGG + Intronic
960980109 3:123215942-123215964 CTAGGTGTTTGGCAGGGAGAGGG + Intronic
961538993 3:127587944-127587966 CTACGTTGTTGGCAGGGGAGTGG - Intronic
961657435 3:128451089-128451111 CTACGTGACTGGCAGGAGGTTGG - Intergenic
962083436 3:132165211-132165233 CTATGTGGCTGGCAGACGGCAGG + Intronic
962097166 3:132303898-132303920 ATAAGTGGCTGGCAGAGGCAAGG + Intergenic
962276914 3:134021536-134021558 ATAAGTGGCTGGCAGAGGCAAGG + Intronic
962349996 3:134649748-134649770 CTATGTGGCTGGTAGTGGCAAGG + Intronic
962710369 3:138081051-138081073 CTACACGGCTGGGAAGGGGATGG + Intronic
964972419 3:162578127-162578149 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
965669001 3:171127081-171127103 CTCTGTGCCTGGCATGGGGAAGG + Intronic
967584094 3:191191150-191191172 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968585812 4:1415452-1415474 CCACGAGGCTGTGAGGGGGAGGG - Intergenic
968663067 4:1806732-1806754 CTCCGGGGCTGGGCGGGGGAGGG + Intronic
968805175 4:2767538-2767560 CTAGGGGGCTGGCTGGGGGAAGG - Intergenic
968977545 4:3829892-3829914 CCACCTGGCTGGGAGGGGCAGGG + Intergenic
969198866 4:5585733-5585755 CTAAGTGGGGGGCAGGGGGTGGG - Intronic
969298730 4:6284964-6284986 CTGGGGGGCTGGCAGGGTGACGG + Intronic
969353917 4:6614112-6614134 GGAAGTGGCTGGCAGGGGCAGGG + Intronic
971280755 4:25240964-25240986 ATAAGTGGCTGGCAGAGGCAGGG - Intronic
971304573 4:25468499-25468521 CTACATGGGTGGCAGGGCTAGGG - Intergenic
971578881 4:28308443-28308465 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
972274906 4:37547732-37547754 ATAAGTGGCTGGCAGAGGCAAGG + Intronic
972324754 4:38004992-38005014 CTCCCTGGCAGGGAGGGGGAGGG + Intronic
974564655 4:63567208-63567230 CTCCCTGGCTGGTAGGGTGAGGG + Intergenic
975487400 4:74949421-74949443 CTACTTGGGAGGCAGGAGGATGG - Intronic
975789097 4:77929073-77929095 CAAAGTGGCTGGCAAGGGAAAGG - Intronic
976174133 4:82335417-82335439 ATAAGTGGCTGGCAGAGGCAGGG - Intergenic
977685073 4:99838087-99838109 CTACGTGGCTGGCAGGGGGATGG + Intronic
980030215 4:127819651-127819673 CCCTGTGGCTGGCAGGGAGAGGG - Intronic
985359457 4:189155857-189155879 CAACGTTGCCGGCTGGGGGAGGG + Intergenic
985632025 5:1018776-1018798 CTAGGTGGTTGGCATGGGCAGGG - Intronic
985898401 5:2764721-2764743 AAGCGTGGCTGGCAGGGAGAGGG - Intergenic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
986785708 5:11112189-11112211 TCACGTGGCTGGCAGGAGGTGGG + Intronic
986933593 5:12855889-12855911 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
987855030 5:23410635-23410657 GTTAGGGGCTGGCAGGGGGAGGG - Intergenic
989496603 5:42116279-42116301 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
991563545 5:67981363-67981385 TTTCGTGTCTGGGAGGGGGATGG - Intergenic
992182444 5:74211754-74211776 CTATGTGGTTGTCAGGGGAAAGG + Intergenic
992408653 5:76483802-76483824 CTGCTTGGCTGGCATGGGGTGGG - Intronic
992455610 5:76912783-76912805 ATAAGTGGCTGGCAGAGGCAAGG + Intronic
992782478 5:80140725-80140747 CTAAGTGGGTGGCAGGGGGGTGG - Exonic
992857289 5:80875499-80875521 CTCTGGGGCTGGCAGGGGTAAGG + Intronic
994454431 5:99986039-99986061 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
995963319 5:117872429-117872451 CTACAAGGCAGGCAGGGGAATGG - Intergenic
997360463 5:133291548-133291570 GTAAGGGGCTGGCAGGGGAAAGG + Intronic
997870128 5:137499095-137499117 CTAGGGGGCTGGCAGGGTCAGGG - Intronic
998093461 5:139383996-139384018 TTATGTGGCTGGGAGGGGAAAGG - Intronic
998160457 5:139810042-139810064 CTATGTGGATTGCAGGGGGTGGG + Intronic
998366852 5:141637560-141637582 CGCCGTGGCAGGCGGGGGGAGGG - Exonic
998384391 5:141748071-141748093 CTCCGAGGTTGGCAGAGGGAGGG - Intergenic
998386847 5:141762153-141762175 CTACATGGCTTGAAGGGAGAGGG + Intergenic
998886121 5:146696069-146696091 CTACTTTGTTGGCGGGGGGATGG - Intronic
1000231651 5:159321107-159321129 CTACTTGGGAGGCAGAGGGAGGG - Intronic
1001095547 5:168772937-168772959 CTAAGTGGCTGCGAGAGGGATGG + Exonic
1001268211 5:170290568-170290590 CTCCATGGCAGGCAGGGAGACGG - Intronic
1001558671 5:172655041-172655063 CTAAGTGGCTGGCAGAGGCAAGG - Intronic
1001640467 5:173240281-173240303 CTAGCTGGCTAGCAGGGGGCTGG - Intergenic
1002954268 6:1846545-1846567 CTAAGAGGCTGGCAGGGACAGGG + Intronic
1004812662 6:19276639-19276661 GTAAGTGGCTGGCAGAGGCAAGG + Intergenic
1004978674 6:20997529-20997551 CCACGGGGGTGGCGGGGGGAGGG + Intronic
1005520876 6:26599233-26599255 TAAGGTGGGTGGCAGGGGGAGGG - Exonic
1006059857 6:31411776-31411798 CTTCCAGGCTGGCAGGAGGATGG - Intronic
1006673960 6:35748823-35748845 CGACTGGGCTGGCAGGAGGAGGG - Exonic
1006848456 6:37079905-37079927 CTAGGTGCCTAGCAGGGGGACGG + Intergenic
1006930825 6:37687222-37687244 CTACGTGTCTGGAAGGGTGGTGG - Intronic
1007396094 6:41578675-41578697 CCATCTGGCTGGCTGGGGGAGGG + Intronic
1008123270 6:47641696-47641718 ATAAGTGGCTGGCAGAGGCAAGG + Intergenic
1009635561 6:66260016-66260038 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
1009725400 6:67531089-67531111 CTACGTTGCTGGCAAGGGTCTGG + Intergenic
1010317723 6:74469594-74469616 ATAAGTGGCTGGCAGAGGCAAGG + Intergenic
1010738403 6:79469088-79469110 CTACGTGTCAGGATGGGGGAGGG + Intergenic
1012590607 6:100975364-100975386 CACCGGGGCTGGCTGGGGGAGGG + Intergenic
1013115809 6:107102956-107102978 CTCCCTGGCTGGCTGAGGGAAGG - Intronic
1013559322 6:111289161-111289183 ATAAGTGGCTGGCAGAGGCAAGG - Intergenic
1016003456 6:139066356-139066378 CATCTTGGCTGGCAGGAGGAGGG - Intergenic
1016681367 6:146833187-146833209 TTGGGTGGGTGGCAGGGGGAAGG - Intergenic
1017997594 6:159546339-159546361 CTACATGGCTGGAAGGTGGAAGG - Intergenic
1018193562 6:161333628-161333650 CTACGTGGGAGGCTGAGGGAGGG + Intergenic
1018888843 6:167966114-167966136 GGGCGTGGCTGGCAGGGGGGTGG - Intronic
1022201720 7:28123618-28123640 TGACGTGGCTGGCAGGGGCCAGG - Intronic
1023077796 7:36501135-36501157 ATAAGTGGCTGGCAGAGGCAGGG - Intergenic
1023798859 7:43815509-43815531 GTAAGTGGCTGGCAGAGGCAGGG + Intergenic
1026201724 7:68220320-68220342 ACACATGGCTGGCAAGGGGAAGG - Intergenic
1026457418 7:70584777-70584799 CTTCGTGGCTGGCAGGACGAGGG - Intronic
1028743879 7:94306313-94306335 CTGAGTAACTGGCAGGGGGAGGG - Intergenic
1028813220 7:95112926-95112948 TTACGAGGGTGGGAGGGGGATGG + Intronic
1032943484 7:136823240-136823262 CTCAGTGGCTGGCTGGAGGAGGG - Intergenic
1033422823 7:141218281-141218303 CAGCCTGGCTGGCAGAGGGAGGG + Intronic
1034236000 7:149569947-149569969 GTAGGTGGCTGGCAGAGGCATGG + Intergenic
1034313631 7:150110892-150110914 CTGCGAGGCTGGCAGGTGGCAGG + Intergenic
1034579552 7:152030854-152030876 ATAAGTGGCTGGCAGAGGAAGGG - Intronic
1034793267 7:153989904-153989926 CTGCGAGGCTGGCAGGTGGCAGG - Intronic
1035683397 8:1506062-1506084 CTATGTGCCTGCCAGGTGGAAGG - Intronic
1036090179 8:5656916-5656938 CGAGGAGGCTGGCAGGGGAAAGG - Intergenic
1036663968 8:10726767-10726789 CTCTGTGGCTGGGAGGGGGAAGG - Intronic
1038039685 8:23714398-23714420 CTAAGAGGCCGGCTGGGGGAGGG - Intergenic
1039877036 8:41595867-41595889 ATAAGTGGCTGGCAGAGGCAAGG - Intronic
1039889184 8:41672782-41672804 CTCCGTGGCCGCCAAGGGGATGG + Exonic
1040951016 8:52939348-52939370 TTACCTGGCTGGCTGGGGAAGGG - Exonic
1042793344 8:72633202-72633224 CTTCCTGGCTGGCAGTGGGTGGG + Intronic
1042930017 8:74004034-74004056 CTAGCTGCCTGGCAGGGGAATGG - Intronic
1043613433 8:82094023-82094045 ATAAGTGGCTGGCAGAGGCAAGG - Intergenic
1047245365 8:123138593-123138615 CTTCGTGGCTGCCAGGGGCAGGG - Intronic
1047246770 8:123152758-123152780 CTACTTGGAAGGCAGGGGGAGGG + Intergenic
1047411020 8:124624680-124624702 CAACGTGGCTGGCATGGTGCAGG - Intronic
1049002338 8:139833998-139834020 CCACGTGGCTGGTAGGGGTTGGG - Intronic
1049773352 8:144393789-144393811 CAGGGTGGCTGGCAGGGGTAGGG + Exonic
1050279489 9:4035532-4035554 CTAGGCCACTGGCAGGGGGAAGG - Intronic
1050325046 9:4490474-4490496 CTACCGGGCTGGCAGGGCGGCGG + Exonic
1051527063 9:18057115-18057137 CTACCTGCCTGTCAGTGGGAAGG - Intergenic
1051575909 9:18615307-18615329 CTGCCTGTGTGGCAGGGGGAGGG + Intronic
1051989141 9:23130069-23130091 CTACTTGGGTGGCTGAGGGAGGG - Intergenic
1053287512 9:36859468-36859490 CCCTGAGGCTGGCAGGGGGAGGG - Intronic
1053528763 9:38856652-38856674 CTACTTGTCTTGCAGGAGGAAGG + Intergenic
1054200990 9:62081085-62081107 CTACTTGTCTTGCAGGAGGAAGG + Intergenic
1054637369 9:67507278-67507300 CTACTTGTCTTGCAGGAGGAAGG - Intergenic
1054715001 9:68548201-68548223 CTAGCTGGGTGGTAGGGGGAGGG + Intergenic
1055009186 9:71544898-71544920 CTACTTGGGTGGGAGGTGGAAGG + Intergenic
1055782627 9:79835720-79835742 CTAGGTGACTGTGAGGGGGAGGG + Intergenic
1055935214 9:81598362-81598384 GTTCGTGGCAGGCAGAGGGAGGG - Intronic
1056130628 9:83583402-83583424 AAATGGGGCTGGCAGGGGGAAGG - Intergenic
1056765063 9:89440124-89440146 CTGCGTGGCTCCCAGGGTGAGGG - Intronic
1057031026 9:91775375-91775397 CCAGGTGGCTGGGAGGAGGAGGG + Intronic
1060717416 9:125945384-125945406 CTATGTGTTTGGCAGGGGGCAGG - Intronic
1060758233 9:126227918-126227940 GTTCTTGCCTGGCAGGGGGAGGG + Intergenic
1062379579 9:136280792-136280814 CTCCTTGGCTGGCAGCGGGGAGG - Intergenic
1062386059 9:136311947-136311969 CACCCTGGCTGGCAGGGGGTAGG + Intergenic
1062478581 9:136741406-136741428 CTCGGTGGCTGGCAGGCGGGAGG - Intronic
1187506612 X:19883531-19883553 CTATGTGACAGGCAGGGGCAGGG - Intronic
1187943211 X:24401694-24401716 GAAGGTTGCTGGCAGGGGGATGG + Intergenic
1188097936 X:26045524-26045546 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
1188136919 X:26502889-26502911 ATAAGTGGCTGGCAGAGGCAGGG + Intergenic
1188513355 X:30959935-30959957 TCACGTGGCTGGCGGGGAGAGGG + Intronic
1189034332 X:37480078-37480100 ATAAGTGGCTGGCAGAGGCAGGG + Intronic
1190304609 X:49074901-49074923 CTACGCAGATGGCTGGGGGAGGG + Exonic
1190771011 X:53513987-53514009 ATAAGTGGCTGGCAGAGGCAAGG + Intergenic
1190885775 X:54530069-54530091 CTACGGGGCAGGCAGGAGGCGGG + Intergenic
1192361965 X:70445859-70445881 CTCTGTGTCTGGCAGGGGGCGGG + Intronic
1198038889 X:132829587-132829609 TGACATGGCTGGCAGGGGCAAGG - Intronic
1198259576 X:134953764-134953786 CTGCTGGGGTGGCAGGGGGAGGG + Intergenic
1199278336 X:145971585-145971607 ATACGTGGCTGGCAGAGGCAAGG + Intergenic