ID: 977685456

View in Genome Browser
Species Human (GRCh38)
Location 4:99842426-99842448
Sequence GTGCATATCCATCAGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977685456 Original CRISPR GTGCATATCCATCAGCACGA GGG (reversed) Intronic
901046261 1:6397685-6397707 GTGTAAATCCATTAGCACTATGG - Intergenic
902620504 1:17648037-17648059 CTGCATTTCCATCACCACCATGG + Intronic
908884796 1:68776419-68776441 GGGCATATCCATCATAAGGACGG + Intergenic
909242156 1:73227597-73227619 ATGTATATCAATCAGCATGATGG + Intergenic
911356590 1:96828430-96828452 GTACATATACATCAGCAAGCTGG - Intergenic
917588524 1:176453118-176453140 GTGCATATCCTTCAACTCTATGG + Intergenic
924603815 1:245515193-245515215 GTGCCGGTCCCTCAGCACGACGG + Intronic
1069123138 10:64594567-64594589 GTGTATATTCATCAGCACACTGG - Intergenic
1075096600 10:119475461-119475483 GAGCACGTCCATCACCACGAGGG + Intergenic
1077434175 11:2530641-2530663 GTGCATACACATGAGCACGTGGG + Intronic
1077707254 11:4498570-4498592 GTGGATATCCATCAAGAAGAGGG + Intergenic
1079084358 11:17434443-17434465 GCGCAAAGCCATCAGCAAGATGG + Intronic
1081108937 11:39107459-39107481 TTGCATATCCATCAACAAAAAGG - Intergenic
1086531052 11:87785494-87785516 TTGAATCTCCATCAGCAGGAAGG - Intergenic
1092214974 12:6674859-6674881 GAGCTTGTCCATCAGCACTAAGG - Intronic
1102083790 12:110119578-110119600 GGGTATATACATCAGCAGGACGG - Intergenic
1103129540 12:118455336-118455358 GTGCATAACCATTAGCAGCATGG + Intergenic
1108691066 13:52859746-52859768 AAGCATCTCCATCAGCACTATGG - Intergenic
1115694378 14:35881071-35881093 GTGCATATCCTTGAGCAGGCTGG - Intronic
1120115297 14:80609506-80609528 GTGCAAATCCATCACCATGTGGG - Intronic
1125514916 15:40313120-40313142 GTTCTTGTCCATCAGCACCACGG + Intergenic
1126353192 15:47766610-47766632 GTTCATATCCTTCAGCACTGTGG - Exonic
1132216015 15:100062188-100062210 GTGCATTTTCATCAGCCCCATGG - Intronic
1136545644 16:30953261-30953283 GTGCACAGCCACCAGCACGGTGG - Exonic
1137833264 16:51564958-51564980 GTACATAGGCAACAGCACGAGGG + Intergenic
1138338904 16:56275342-56275364 GTTCAGATCCACCAGAACGAGGG + Intronic
1139016758 16:62698697-62698719 GTGTATATACATCATCACGTGGG + Intergenic
1140876193 16:79154645-79154667 GTGTACATCCATCAGCATAAGGG - Intronic
1141104314 16:81220720-81220742 GTGCAAAGCCATCAGCATGTGGG + Intergenic
1141454826 16:84134195-84134217 CAGCATATCCAGCAGCAGGAGGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1159825457 18:73203193-73203215 GTGCTTTTCCATCAGCAAGAGGG + Intronic
925605668 2:5657459-5657481 CAGCCTCTCCATCAGCACGAAGG + Intergenic
928867219 2:35931228-35931250 CTGCATATCCATCATCACTGCGG + Intergenic
932415740 2:71572947-71572969 GTGCTCATCCATGTGCACGATGG - Intronic
936795928 2:116204215-116204237 GTGCCTGTCCATCAGCAGGAGGG + Intergenic
940097667 2:149996173-149996195 CTACATATCCATCAGCAGCATGG + Intergenic
942918317 2:181339700-181339722 CTGCATAACCATCATCACAATGG + Intergenic
945320183 2:208412229-208412251 GGTAATATCCATCAGCAAGAAGG - Intronic
1174415905 20:50366800-50366822 GGGCAGTTCCATCAGCAGGAAGG - Intergenic
1177298153 21:19203951-19203973 CTGCATATCCATGTGCACAATGG + Intergenic
1179097561 21:38329222-38329244 GTGCAAATCCACCAGCTAGAAGG - Intergenic
1183672694 22:39282566-39282588 GAGCGTGTCCATGAGCACGAGGG + Intergenic
949636168 3:5983551-5983573 GTTCAAATCCATCAGCACAGAGG - Intergenic
956464558 3:69506188-69506210 GGGCCAATCCATCAGCACCACGG - Intronic
964195389 3:154058557-154058579 GTTCATATCCACCACCACCAAGG + Intergenic
965847145 3:172976846-172976868 GGGCATATCAATCAGAAAGAAGG - Intronic
967963776 3:194944847-194944869 TTGCCAATCCATCAGCACAAGGG - Intergenic
972576166 4:40354030-40354052 GTGGATATTCATCACCATGATGG - Exonic
977685456 4:99842426-99842448 GTGCATATCCATCAGCACGAGGG - Intronic
990668134 5:58096539-58096561 CTGAATATCCATCATCACAAAGG - Intergenic
991472024 5:66979199-66979221 GTGCATCTCCAACAGCAGGCTGG - Intronic
991631826 5:68664340-68664362 GTGCATACCCACCAGGAAGAAGG - Intergenic
1000040370 5:157480628-157480650 GAGCATCTCCATCAGCACCTCGG + Exonic
1002550469 5:179986384-179986406 GAGCATTTCCAGCAGCACTATGG + Intronic
1009095719 6:58977733-58977755 TTGCAGATCCTTCAGCAAGAGGG - Intergenic
1013872740 6:114786669-114786691 GTGCATATCTATGAGCATAACGG - Intergenic
1014310091 6:119788905-119788927 GTGCAAATCCATCTGCACTCTGG + Intergenic
1019716242 7:2540772-2540794 GTGAAGATACATCAGCACGCAGG - Intronic
1025254683 7:57375943-57375965 GAGCAGTTCCATCAGCAGGAAGG + Intergenic
1027369811 7:77496116-77496138 GTGCATATCCACCTGCCCTAAGG - Intergenic
1035866265 8:3085799-3085821 TTGCATATCCATCAGAAAGATGG + Intronic
1037486774 8:19355282-19355304 GTGCATTTCCACCACCAGGAAGG - Intronic
1039177536 8:34826353-34826375 GTCCATCCCTATCAGCACGAAGG - Intergenic
1049831696 8:144705020-144705042 CTGCATTTCCTTCAGCATGAAGG - Intergenic
1053285739 9:36848538-36848560 CGGCATATCCATCAGCACCACGG + Intronic
1054475653 9:65570874-65570896 CTCCATATCCATCAACAAGATGG + Intergenic
1056459517 9:86795981-86796003 GTGCATAGCCCTCACCACCAGGG - Intergenic
1203563447 Un_KI270744v1:75463-75485 GAGCATATCCGTCTGCACCATGG - Intergenic
1185519397 X:727712-727734 GCGCATCTCCATCAGCTCCAGGG - Intergenic
1185771682 X:2769637-2769659 GTGCATATATGTCAGCAAGAGGG + Intronic
1187144448 X:16625170-16625192 GTGCATATCCATCCACACAATGG + Intronic
1187402482 X:18974049-18974071 GAGCACATCCATCAAAACGAGGG - Intronic
1197477098 X:126939344-126939366 GTGCATTTCCATTTGTACGAAGG - Intergenic
1201159987 Y:11159031-11159053 GAGCATATCCGTCTGCACCATGG + Intergenic
1201298896 Y:12489397-12489419 GTGCATATATGTCAGCAAGAGGG - Intergenic