ID: 977688231

View in Genome Browser
Species Human (GRCh38)
Location 4:99873796-99873818
Sequence GGTAAGTAAGCACTGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977688228_977688231 -5 Left 977688228 4:99873778-99873800 CCCTAGGATTTTCAAAATGGTAA 0: 20
1: 170
2: 372
3: 525
4: 792
Right 977688231 4:99873796-99873818 GGTAAGTAAGCACTGGCTTCAGG No data
977688229_977688231 -6 Left 977688229 4:99873779-99873801 CCTAGGATTTTCAAAATGGTAAG No data
Right 977688231 4:99873796-99873818 GGTAAGTAAGCACTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977688231 Original CRISPR GGTAAGTAAGCACTGGCTTC AGG Intergenic
No off target data available for this crispr