ID: 977689181

View in Genome Browser
Species Human (GRCh38)
Location 4:99884952-99884974
Sequence TTTTCTTCCAAGACAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2135
Summary {0: 1, 1: 0, 2: 16, 3: 216, 4: 1902}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977689181_977689182 11 Left 977689181 4:99884952-99884974 CCAGACTCTGTCTTGGAAGAAAA 0: 1
1: 0
2: 16
3: 216
4: 1902
Right 977689182 4:99884986-99885008 GTAACTTACATCAATTGATTAGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977689181 Original CRISPR TTTTCTTCCAAGACAGAGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr