ID: 977689330

View in Genome Browser
Species Human (GRCh38)
Location 4:99887783-99887805
Sequence TTACATTGGAAGCCATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977689330 Original CRISPR TTACATTGGAAGCCATGTGA AGG (reversed) Intronic
902475630 1:16684221-16684243 TTCCTTTTGAAGCCATGTGAAGG + Intergenic
902592343 1:17484117-17484139 TTAGAATGGAAGCCCTGGGAGGG - Intergenic
902854981 1:19195511-19195533 GTACATTGAGATCCATGTGAGGG + Intronic
902889704 1:19433522-19433544 TGTCTTTGGAAGCCATGTGCAGG - Intronic
906860731 1:49356344-49356366 GAACATTTGAAGGCATGTGAAGG - Intronic
910549596 1:88461025-88461047 TTAAATTGAAATGCATGTGATGG - Intergenic
910979990 1:92950470-92950492 TTACTTTGGAAGCAATGTGGAGG + Intronic
913945299 1:125156605-125156627 TTCCATTTGAAACCATTTGATGG + Intergenic
917325658 1:173829372-173829394 TTGAATTTGAAGCCATGTGACGG + Intronic
918538553 1:185602704-185602726 TGACTTTGGGGGCCATGTGAAGG + Intergenic
918652548 1:186983730-186983752 TTACACTGGTAGACATGTGATGG + Intronic
921649511 1:217659909-217659931 TTACATTGTATGCTATGGGAAGG - Intronic
921931323 1:220756649-220756671 CTTAATTGGAAGACATGTGAAGG + Intronic
922484723 1:225964458-225964480 TTTTATTGGGAGCCATGCGAGGG - Intergenic
924571899 1:245244622-245244644 TCACATTGGAAGTCAGGGGAGGG - Intronic
1063724362 10:8620778-8620800 TTCCATTGGCAGCAATTTGAAGG + Intergenic
1064126313 10:12663861-12663883 GCACATTGTAAGCAATGTGAGGG + Intronic
1065274842 10:24075540-24075562 TTACTTGGGAAGCCATGGAAGGG - Intronic
1066562264 10:36682965-36682987 TTAAATTGGATGTCATGTAAAGG + Intergenic
1066744437 10:38592409-38592431 TTTCATTCGATTCCATGTGATGG - Intergenic
1068479639 10:57574360-57574382 GTACATTGTAAGGCTTGTGAAGG - Intergenic
1069444123 10:68457166-68457188 TTAGAATGGAAGCCATTGGAGGG - Intronic
1070771927 10:79087581-79087603 TCACACTGGTAGCCAAGTGAAGG - Intronic
1073313180 10:102558942-102558964 TTACATGGCAAGCCATCTGGAGG + Intronic
1075981254 10:126741975-126741997 TTACATTGGAGGCTGTGGGATGG - Intergenic
1080195548 11:29604374-29604396 TTAAAATGTAAACCATGTGAGGG - Intergenic
1080388118 11:31822051-31822073 TTAAATTGGAGGCCAGGGGAAGG + Intronic
1080399702 11:31922437-31922459 TTTCATAGGAAGCCAAGGGAGGG - Intronic
1085358007 11:75857212-75857234 TGAGATGGGAAGCCATGGGAGGG - Intronic
1088363287 11:109013302-109013324 GTACCTTGGAAGCCATGTGCTGG + Intergenic
1091247410 11:134109976-134109998 TTAGAGTGAAAGCAATGTGAAGG - Intronic
1092040453 12:5379668-5379690 TTAGATTGTAAGCCTTTTGAAGG + Intergenic
1095275520 12:40277974-40277996 TGATATTGGAAGACATTTGATGG - Exonic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097300350 12:58011949-58011971 TTACAATGGAAGTCATGTCTTGG - Intergenic
1098543254 12:71683393-71683415 TTACTTTGGAAGCCATTTTCTGG - Intronic
1099209338 12:79765154-79765176 TGAGACTGGAAGCCATTTGAAGG - Intergenic
1099484428 12:83210696-83210718 TTAAATTGGAAGCGAAGTCAGGG + Intergenic
1100828648 12:98497945-98497967 TCATATTGGCAGTCATGTGAAGG - Intronic
1100993152 12:100272053-100272075 TTCTATTGAAAGCCAGGTGATGG + Intronic
1102770195 12:115469480-115469502 TTCCCTAGGAAGCCATGCGATGG - Intergenic
1103372604 12:120430736-120430758 TTAGATTGTAAGCCACATGAGGG - Intergenic
1105272005 13:18885550-18885572 TTTCATTGGATGTCTTGTGAAGG - Intergenic
1107368294 13:39710976-39710998 TTACATTGGAGCCCATGAGTGGG + Intronic
1108271375 13:48763097-48763119 TTACATAGGAATCCATGTCATGG + Intergenic
1109971358 13:69773782-69773804 TTACATGCAAAGCAATGTGAAGG + Intronic
1111082169 13:83324739-83324761 TTACATTGGTAAACATGTCAGGG - Intergenic
1115741898 14:36397729-36397751 CTACATTAGAAGCCCTGTTATGG - Intergenic
1115875897 14:37861678-37861700 AAACATTGGAAGCCATCTAAAGG + Intronic
1116265970 14:42690688-42690710 TTGCAGTTGAGGCCATGTGATGG + Intergenic
1116310212 14:43315791-43315813 TTACATGGGAAGCATTGTCAAGG + Intergenic
1118751970 14:68814251-68814273 CTACAATGGAAGGCATTTGAAGG + Intergenic
1118788641 14:69068177-69068199 TTATATTGGAAGCTCTCTGAAGG + Intronic
1120313410 14:82860547-82860569 TTACATGGGGAGCCCTATGAAGG + Intergenic
1120975938 14:90248301-90248323 TGACCTTGGGAGCCATGTAACGG - Intergenic
1125581988 15:40792478-40792500 TTTCATTTGAAGCCCTTTGAAGG - Intronic
1127716729 15:61655698-61655720 TGACATTTGATGCCATGTGCTGG - Intergenic
1128535079 15:68484639-68484661 TGACTTTGGTAGCCATGTGGAGG + Intergenic
1128762494 15:70226968-70226990 TTCCTTTGGGAGCAATGTGAGGG + Intergenic
1128814998 15:70601930-70601952 TCACATGGGAACACATGTGAGGG + Intergenic
1130159252 15:81382618-81382640 TTAGATTGGAGGGGATGTGAAGG - Intergenic
1130245091 15:82239809-82239831 TTAAAATGGAAGCCTTGAGATGG - Intronic
1130334737 15:82949252-82949274 TGGCATTTGAAGCCATGGGAGGG + Intronic
1133592866 16:7263173-7263195 TTACATTCTAAGCCACTTGATGG + Intronic
1136297098 16:29309812-29309834 TCACATTGGATGGCATCTGAGGG + Intergenic
1136937682 16:34488843-34488865 TTCCATTGGGATCCATTTGATGG - Intergenic
1136962135 16:34859704-34859726 TTCCATTGGGATCCATTTGATGG + Intergenic
1137091552 16:36197882-36197904 TTCCATTGGATTCCATTTGATGG + Intergenic
1138719505 16:59062769-59062791 ATACAATTGAAGCCATGTGGTGG + Intergenic
1139148006 16:64345671-64345693 TTCCATGGGAGGCCATGGGAAGG - Intergenic
1139458737 16:67105466-67105488 TGACACTGGAAACCATTTGAGGG + Intergenic
1141053148 16:80791428-80791450 TTACATTGTAAGCTTTGTGAGGG - Intronic
1142058648 16:88015916-88015938 TCACATTGGATGGCATCTGATGG + Intronic
1144067346 17:11636528-11636550 TTACATTGGTAGGCATATAAAGG + Intronic
1144316084 17:14062904-14062926 TTCCATTGGAGGCTTTGTGAAGG - Intergenic
1144424004 17:15123994-15124016 TTACATTCGAAGCCCTTTGAGGG - Intergenic
1145009347 17:19358756-19358778 GCACATTGAAAGCCATGAGATGG - Intronic
1145107951 17:20135786-20135808 TTACATTAGGAACCATGTGTGGG + Intronic
1146447847 17:32946987-32947009 AGACATTGCAGGCCATGTGAAGG + Intergenic
1146647963 17:34587821-34587843 TCACATTGGCTGCTATGTGAAGG + Intronic
1147054866 17:37826319-37826341 TTAGACTGGAAGCCGTGTGAAGG - Intergenic
1147392429 17:40118490-40118512 TGAGATGGGAAGCCATGAGAGGG + Intergenic
1150929257 17:69566289-69566311 TCAGATTGGAAGACCTGTGAAGG + Intergenic
1151190985 17:72397840-72397862 TCACATGGGAAGCACTGTGATGG - Intergenic
1152049418 17:77960101-77960123 TTGCATTCGAAGGCATTTGACGG + Intergenic
1203184407 17_KI270729v1_random:99644-99666 TTCCATTCGAATCCATTTGATGG + Intergenic
1156845619 18:41662594-41662616 TCACATAGGAAGCCATGAGTTGG + Intergenic
1157303719 18:46500663-46500685 TAATATTGTAAGCCATGTCAAGG - Intronic
1157383364 18:47241097-47241119 CTTGATTGGAAGCAATGTGAGGG + Intronic
1157572404 18:48721666-48721688 TGCCATTAGATGCCATGTGATGG + Intronic
1157888130 18:51388591-51388613 TGTCATTGGAAGCCATGTAGGGG - Intergenic
1159646907 18:70929924-70929946 CTACATTTGAATTCATGTGATGG - Intergenic
1159989793 18:74891182-74891204 TGAGATTGGACCCCATGTGATGG + Intronic
1161964120 19:7538922-7538944 TTATCTTGGAAGCTATGTCAGGG + Intronic
1165214751 19:34262613-34262635 TTATCTTGGCAGCCATGTGCAGG - Intronic
1167222433 19:48209808-48209830 TTACAGTAGAAGACATGAGAAGG + Exonic
928025806 2:27737697-27737719 TCACATTGAATGCCATGTGATGG + Intergenic
928761505 2:34588464-34588486 TTACATTTTAAGCTCTGTGAAGG + Intergenic
931417319 2:62093275-62093297 TGACCTTGGGAGCCATGTAAGGG + Intronic
933446700 2:82389152-82389174 TAACATAGCAAGCTATGTGAGGG - Intergenic
934120399 2:88832535-88832557 TAACATTTGCAGCCATGGGATGG - Intergenic
934546353 2:95220008-95220030 TTTCAGTGGAAGCCAAGTGGGGG - Intronic
935868311 2:107416438-107416460 TTACAATGGAAAACATGTGAAGG - Intergenic
936061101 2:109296188-109296210 TTAGAGTGGAAGCCAGGAGATGG - Intronic
936901024 2:117481998-117482020 ATACATTGAAAGCCAGATGATGG - Intergenic
937458925 2:122068716-122068738 TTACAATGTAAACCATATGAAGG + Intergenic
938277056 2:130036528-130036550 TTACATAGGTAGACATGTGCCGG - Intergenic
940204827 2:151191291-151191313 TTACATTGGAAGGCAATTCAGGG - Intergenic
940600298 2:155850258-155850280 TTAAACTGTAAGCTATGTGATGG + Intergenic
941751449 2:169139185-169139207 ATTCATATGAAGCCATGTGAAGG - Intronic
944243517 2:197508572-197508594 TTACATTGAAAGCAATGTGATGG - Intronic
945384082 2:209176183-209176205 TTATCTTAGAAGCCAAGTGAAGG + Intergenic
1172521373 20:35568677-35568699 TTACATGGGAAGCCATAGGAAGG - Intergenic
1173093688 20:40002669-40002691 TAACATTAGAAGCTAGGTGAAGG - Intergenic
1174233651 20:49069217-49069239 TTTTATTGGAAGCCATATGAGGG + Intronic
1175651679 20:60730031-60730053 TTAAAATAGAAGCCATGTGATGG - Intergenic
1175763909 20:61580071-61580093 TTACAGTGCAACCCAGGTGAAGG + Intronic
1176790131 21:13310802-13310824 TTACATGGGCAGCCATGGGCAGG + Intergenic
1177408926 21:20705135-20705157 TTACAGTGGAAGGCATGGGTGGG - Intergenic
1177507023 21:22032678-22032700 TTACAGTGGATGCCTTATGATGG + Intergenic
1177989311 21:28019009-28019031 TTACATGGGCAGCCATGGGCAGG + Intergenic
1179129389 21:38621133-38621155 TGGGATTGGAAGCCATGGGATGG + Intronic
1180501835 22:15936751-15936773 TGACCTTGGGAGCCATGTAAGGG + Intergenic
1182149965 22:28020987-28021009 CTGCCTTGGAAGCCAGGTGAGGG - Intronic
1182596283 22:31423441-31423463 CTGAATTGGAAGCCTTGTGATGG + Intronic
1183362039 22:37387813-37387835 TGACATTAGAAGCCTTGGGAAGG - Intronic
950908967 3:16567558-16567580 TCACACTGTAATCCATGTGATGG + Intergenic
952544650 3:34405978-34406000 ACACAATGGAAGCCATCTGAGGG + Intergenic
953242732 3:41164162-41164184 TTACATGGGATGCCAGGGGAAGG + Intergenic
953510889 3:43537869-43537891 TTAAATTAGAAACTATGTGACGG - Intronic
955951296 3:64244987-64245009 TTAGATTGGTAGCGATGTTATGG - Intronic
956727222 3:72165874-72165896 TTTCATTGGCAGCAATGAGAAGG - Intergenic
957651153 3:83006363-83006385 TAACATTGTAAACCATGGGATGG - Intergenic
960372870 3:116862578-116862600 TTCCATTGGCAGCCAGGGGAAGG - Intronic
962663099 3:137625248-137625270 TTTAAATGGTAGCCATGTGATGG - Intergenic
963482777 3:145897376-145897398 TTACACTGGAAGCAATTTAAAGG - Intergenic
963623787 3:147645698-147645720 GTACATAGGAAGCAATGTGTGGG - Intergenic
966644416 3:182227490-182227512 TTAGATTGGAAGCAACATGAGGG - Intergenic
966776359 3:183546054-183546076 TGAAAATGCAAGCCATGTGAAGG - Intronic
966907318 3:184536469-184536491 TGAATTTGGAAGCCATGTTATGG - Intronic
967093374 3:186154330-186154352 TTACATTCGAAGGCCTCTGATGG - Intronic
968853390 4:3100369-3100391 ATACCATGGAAACCATGTGATGG - Intronic
971559383 4:28056678-28056700 TTACATTAGAGGCATTGTGATGG + Intergenic
971792731 4:31189337-31189359 TGACATTTGAACCCAGGTGAAGG - Intergenic
973325742 4:48859375-48859397 TTAGATTGTAAGCTCTGTGAGGG + Intronic
974336543 4:60553716-60553738 TAAAATTAGAAGCCATGTGTAGG + Intergenic
975470784 4:74764353-74764375 TTACTATGGAAGACGTGTGATGG + Intronic
976493663 4:85700557-85700579 TTACAGGGGAAGCCAGCTGATGG + Intronic
977689330 4:99887783-99887805 TTACATTGGAAGCCATGTGAAGG - Intronic
979181434 4:117733716-117733738 TTACATTGAAAACTATGGGATGG + Intergenic
979352038 4:119655376-119655398 TTACATGGGAATCCATGTGAAGG - Intergenic
981956313 4:150478151-150478173 TGAAATTTGAAGCCATGAGAGGG - Intronic
987130203 5:14853115-14853137 TTGCATTGTAAGGCATGTGGTGG - Intronic
987782317 5:22454972-22454994 GCTCATTAGAAGCCATGTGAAGG + Intronic
987840892 5:23221485-23221507 TCAAATTGCCAGCCATGTGATGG - Intergenic
989022953 5:37031490-37031512 ACACATTGATAGCCATGTGATGG + Intronic
993202010 5:84828983-84829005 TTACATTGCAAACCCTGAGAAGG - Intergenic
993408033 5:87536588-87536610 TAGCAATGGAAGCAATGTGAAGG + Intergenic
993427252 5:87782099-87782121 TTACATTGGACACTTTGTGAAGG - Intergenic
994517979 5:100794339-100794361 TTCCATGGGCAGCCATGTGTGGG - Intergenic
994747044 5:103691516-103691538 TTTCATTAAAAGCTATGTGAGGG + Intergenic
995219809 5:109635216-109635238 TTACATTGGCATCCATGAAAGGG + Intergenic
996001336 5:118368235-118368257 TTATATTGGAAGCTCTTTGAGGG + Intergenic
997737851 5:136227601-136227623 TTAGGTTGGAAGCTTTGTGAGGG + Intronic
998525345 5:142837832-142837854 TTTCATCTGAAGCAATGTGAGGG - Intronic
1001191010 5:169631371-169631393 TTCCAAAGGCAGCCATGTGATGG + Intergenic
1202773662 5_GL000208v1_random:38524-38546 TGACATTTGAAGCAATTTGAGGG - Intergenic
1202773677 5_GL000208v1_random:38866-38888 TGACATTTGAAGCAATTTGAGGG - Intergenic
1003632974 6:7804719-7804741 TTAGAATAGAAGCTATGTGAAGG - Intronic
1004073646 6:12325488-12325510 GTAGAATAGAAGCCATGTGAGGG - Intergenic
1004729433 6:18343429-18343451 TTACATTCCTGGCCATGTGAAGG + Intergenic
1009850019 6:69184237-69184259 TGACATTAGAAGCCAGCTGATGG - Intronic
1010321393 6:74514514-74514536 TTACATAGGTATACATGTGATGG + Intergenic
1010357790 6:74954733-74954755 TTCAATTGGAAGCTCTGTGAGGG - Intergenic
1012444555 6:99294490-99294512 ACACACTGGAAGCCATGAGAGGG + Intronic
1013342065 6:109224586-109224608 TTACAGTGGAAGACATTTGAAGG - Intergenic
1013889099 6:115004591-115004613 TTATATTGGAACCCATTTGATGG - Intergenic
1014725846 6:124970976-124970998 TTTCATTGGCAGCCATGGGATGG + Intronic
1014755522 6:125298447-125298469 TTAGATTGGTAAACATGTGAAGG - Intronic
1015055383 6:128896353-128896375 TTACTTTGGAATCCATGTCCTGG + Intronic
1015228596 6:130887088-130887110 TTACATTTGAAGCCATTTCTAGG - Intronic
1016665238 6:146631988-146632010 ATACCTTGGAAACCAAGTGAAGG - Intronic
1017695131 6:157007179-157007201 TTCCATTTGAAGGCATGTGCGGG - Intronic
1025555474 7:62302342-62302364 TTCCATTAGAGGCCATTTGATGG - Intergenic
1029871948 7:103703709-103703731 TTACATTGGAAGTGACCTGAAGG - Intronic
1030744999 7:113154340-113154362 TTACCATGGAAGCAATGTCACGG - Intergenic
1033604877 7:142919619-142919641 TTAAATTGCAAGCCATGTTGTGG - Intronic
1035793635 8:2332422-2332444 TTTCAGTGGAAACCATTTGAAGG - Intergenic
1035799168 8:2389283-2389305 TTTCAGTGGAAACCATTTGAAGG + Intergenic
1035942137 8:3913257-3913279 TGACAATGGAAGCCATGGGGAGG + Intronic
1036670991 8:10787587-10787609 TTACACTGTAAGCTATGTGATGG + Intronic
1038240291 8:25801845-25801867 TCACATTGTGAGCCCTGTGAGGG + Intergenic
1038297997 8:26314084-26314106 TTACATTAGAAGGCTTTTGAAGG - Intronic
1040985012 8:53284419-53284441 TGTCATTGGCAGCAATGTGATGG + Intergenic
1043405722 8:79930558-79930580 TGAGATTGGAAGCCAGGTTAAGG - Intronic
1046135821 8:110025962-110025984 TAACTTTGGAAGCCAGGTTAAGG + Intergenic
1047099505 8:121660765-121660787 TGACATTCGAACCCATGTGATGG + Intergenic
1052607733 9:30726576-30726598 TTTAATTGGAAGGCCTGTGAAGG - Intergenic
1056226776 9:84503650-84503672 TTACATTAGAAGTCTAGTGAGGG + Intergenic
1056341251 9:85634536-85634558 TGAGATTGGAAGCCATGACAGGG + Intronic
1056518623 9:87379345-87379367 TTACATTAGTTGCCATATGAGGG + Intergenic
1057552350 9:96061236-96061258 TTACAAGGAATGCCATGTGAAGG + Intergenic
1059012568 9:110477904-110477926 TTAAATGGAAAGCCATTTGAGGG - Intronic
1059806324 9:117804727-117804749 TGCCATTAGAAGCAATGTGAAGG - Intergenic
1187534485 X:20126912-20126934 TTCCTTTTGAAGCCATGTGAAGG + Exonic
1187960429 X:24562371-24562393 TTTGAGTGGAAGCCATGAGAAGG + Exonic
1189940824 X:46118792-46118814 TTAAATTGAAAGCCATTAGAGGG + Intergenic
1191903042 X:66058127-66058149 TTATTTTGGAAGCCATGTGCAGG - Intergenic
1192042364 X:67636113-67636135 TTAGAATGGAAGCTCTGTGAAGG + Intronic
1192223573 X:69213579-69213601 TGACATCGGAAGCCTTGGGAGGG + Intergenic
1192938755 X:75890428-75890450 TCACATTGGAAGACTTTTGAAGG - Intergenic
1194023438 X:88722785-88722807 TTAAATTGGTGTCCATGTGAGGG - Intergenic
1195881504 X:109597434-109597456 TCACATTGTACCCCATGTGATGG + Intergenic
1198279894 X:135131265-135131287 ATTCATTGAAAGCAATGTGATGG + Intergenic
1198291063 X:135241249-135241271 ATTCATTGAAAGCAATGTGATGG - Intergenic
1199172118 X:144744422-144744444 TGACCTTGGGAGCCATGTAAGGG - Intergenic
1202275131 Y:23110015-23110037 TCACATTGTAGTCCATGTGATGG + Intergenic
1202290897 Y:23310674-23310696 TCACATTGTAGTCCATGTGATGG - Intergenic
1202428122 Y:24743737-24743759 TCACATTGTAGTCCATGTGATGG + Intergenic
1202442669 Y:24926354-24926376 TCACATTGTAGTCCATGTGATGG - Intergenic