ID: 977692164

View in Genome Browser
Species Human (GRCh38)
Location 4:99925402-99925424
Sequence CTTTGTGACCAAATGCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977692164 Original CRISPR CTTTGTGACCAAATGCAATT TGG (reversed) Intronic
902254291 1:15177549-15177571 GTCTGTGACCAACTGCATTTGGG - Intronic
903300617 1:22376021-22376043 CTTTCTGACCACTTGCAAATTGG + Intergenic
906983590 1:50658001-50658023 CAATTTAACCAAATGCAATTGGG + Intronic
908000275 1:59672444-59672466 CTTGGTTCCCAAATGCAAATGGG - Intronic
909728015 1:78859069-78859091 GTTTGTGCCCAATTGTAATTAGG + Intergenic
909818289 1:80025247-80025269 TTCCGTGACCAAATGCAAGTGGG + Intergenic
910640532 1:89456624-89456646 CTTTGTTGGCAAATGCTATTAGG - Intergenic
911118542 1:94271902-94271924 CTTTGTGTCCAGAGGCAAGTAGG + Intronic
911532870 1:99066301-99066323 CTTTGTTACCAATTGCCATGTGG + Intergenic
916325090 1:163547834-163547856 CTTTGTGACCAAACTAAATAAGG + Intergenic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
919117104 1:193294564-193294586 CCTTGGGACCAGATGCATTTGGG - Intergenic
919217878 1:194583483-194583505 ATTTGTGACCAAATAGCATTTGG - Intergenic
922079812 1:222284703-222284725 ATTTGGGAACAAATGCAATATGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924716882 1:246583728-246583750 CTTTGTAACCAAAAGCCACTTGG - Intronic
1064230517 10:13526081-13526103 CATCGTGACCATTTGCAATTAGG - Intronic
1065156296 10:22873398-22873420 CTTGGTGATCAAATGGAAATTGG - Intergenic
1066320707 10:34300994-34301016 CTTTGTGAGAATCTGCAATTAGG + Intronic
1066512307 10:36115030-36115052 CTTTGTGTCAAAATGCACTGTGG + Intergenic
1070429967 10:76327857-76327879 CTTTGTGACTAAATGCTTTCTGG - Intronic
1072937569 10:99728089-99728111 CTTTTTTACCAAAAGGAATTAGG + Intronic
1074725783 10:116307547-116307569 CTTTGTGGCCAAATAAATTTGGG + Intergenic
1080516548 11:33027057-33027079 CCTTGGGACCAGATGCATTTAGG + Intronic
1080778455 11:35408150-35408172 CTTGGTGACCAAGTGCAAGTAGG - Intronic
1081019052 11:37920441-37920463 ATTTGTGACTAAAATCAATTGGG - Intergenic
1081047124 11:38289878-38289900 GATTCTGTCCAAATGCAATTGGG - Intergenic
1081058492 11:38441626-38441648 CTTCGTGACCAACTCCAATTTGG - Intergenic
1085354593 11:75824327-75824349 TTATGTGACAAAATGCTATTAGG + Intronic
1085845661 11:80061686-80061708 CTATGTGAGCATATGCAATGGGG + Intergenic
1087325631 11:96720071-96720093 CGTTTTGACCTAATGCAGTTAGG + Intergenic
1088945944 11:114512628-114512650 CTTTGTGTCCAAATACATATTGG - Intergenic
1088967499 11:114738467-114738489 CCTTGGGACCTAAAGCAATTGGG + Intergenic
1089751185 11:120652425-120652447 CCTTGTGGCCTAATGCAGTTGGG - Intronic
1089794905 11:120972478-120972500 CTTTTTGACCAGATCCTATTAGG - Intronic
1094658284 12:32441775-32441797 CTTAGAGACCAAAAGCACTTTGG + Intronic
1095474636 12:42573395-42573417 CTATGTGGCCAACTGCAATTCGG + Intronic
1095579777 12:43784265-43784287 TTCTGTGACCAAATGCGACTGGG + Intronic
1097548732 12:61039172-61039194 ATTTGTGACCAAATGAGATAGGG + Intergenic
1099419059 12:82430021-82430043 CTTTGTAAGAAAATGCAATTGGG - Intronic
1100664873 12:96740271-96740293 ATTTGTGAACTAATGGAATTGGG + Intronic
1101737285 12:107472493-107472515 CTGTGTGACCTTAGGCAATTTGG + Intronic
1102267815 12:111503181-111503203 ATTTGTGAACAAATGCAGTTTGG + Intronic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1109623280 13:64939785-64939807 CTTTGGGAACAAATACAATCAGG - Intergenic
1109681070 13:65753707-65753729 TTTTGTAATCAAATTCAATTTGG - Intergenic
1110648572 13:77917933-77917955 CTTTGGAACCAAATTCCATTTGG - Intronic
1110785429 13:79519183-79519205 CTTTGTGACAAAATTTATTTGGG + Intronic
1112094833 13:96121012-96121034 CTTTGTGCCCAAGTTTAATTAGG - Intronic
1112847928 13:103666864-103666886 CTGTAGGACCAAATTCAATTTGG - Intergenic
1115855230 14:37623028-37623050 CATTTTTCCCAAATGCAATTTGG + Intronic
1117056331 14:51915693-51915715 TTTTGTGACTAAATGCTATTTGG + Intronic
1118884620 14:69856090-69856112 CTTTGTGACCAAGTCCAATGTGG + Intronic
1121082416 14:91119076-91119098 CTTTTTGAGCAAATGTATTTTGG - Intronic
1122026273 14:98879756-98879778 CCTTCTGAGTAAATGCAATTTGG - Intergenic
1122346450 14:101064005-101064027 CTCTATGACCAAATGACATTCGG - Intergenic
1126646383 15:50879087-50879109 CTTTGGGACTAAAGGTAATTGGG + Intergenic
1127653022 15:61027796-61027818 CTTTGAGAGAAAATGTAATTTGG - Intronic
1127817916 15:62628734-62628756 TTTTGTGACCAAATCCCATAAGG - Intronic
1129491489 15:75930487-75930509 TTTTGTGACCAAACACATTTGGG - Intronic
1131394173 15:92073618-92073640 CTTTGAGATCAATTGCACTTCGG + Intronic
1131586698 15:93703257-93703279 CTTTGTAACCACATCCAATTTGG - Intergenic
1131784399 15:95896277-95896299 CTTTGAAACTAAATGCATTTAGG - Intergenic
1132297841 15:100755352-100755374 CTTTGTGAACAAATGGAACAAGG + Intergenic
1132819093 16:1853267-1853289 CTTTTTAAACAAATGCAGTTGGG - Exonic
1135435894 16:22426373-22426395 CTGTGTGCTCAAATGTAATTTGG - Intronic
1138775250 16:59714356-59714378 CTTTGTGTCCATATTCAATGAGG + Intronic
1138840363 16:60494822-60494844 TTTTTTGACAAAATGCAATCTGG - Intergenic
1139434811 16:66930290-66930312 CCAGGTGACCAAATGCAATCTGG + Intergenic
1139957513 16:70700184-70700206 CTTTGTTACCAAATGCTCTGGGG - Intronic
1141407178 16:83804718-83804740 CCATGTGACCACATGCAATGAGG - Intergenic
1141601624 16:85130202-85130224 CTTTGTCTCCAACTGAAATTTGG + Intergenic
1147009562 17:37434081-37434103 CATTATGACTAAATGCAATGTGG - Intronic
1148648301 17:49231585-49231607 CTTTGTGACCCAATGGAGTCAGG - Intergenic
1153020590 18:625382-625404 CTATGATTCCAAATGCAATTTGG - Intronic
1155296467 18:24389109-24389131 CATTGTGACCAGCTGCATTTGGG - Intronic
1155354052 18:24934441-24934463 CTTTGTGATGAAATGCAGATTGG + Intergenic
1157059571 18:44272183-44272205 CTTTGTGGTCAAATTCAAGTTGG + Intergenic
1159912671 18:74161379-74161401 CTTTGTGACCAAGTGCATGTGGG + Intergenic
1162064340 19:8116030-8116052 CCTTGTGAACAAATGCATTTAGG - Intronic
927680340 2:25134938-25134960 CTTTGTGACTAAAGCCAGTTTGG - Intronic
930545628 2:52763576-52763598 TTTTGTGATCAAATACATTTGGG - Intergenic
931348026 2:61464460-61464482 CTTTTTCACCAAATGGTATTGGG + Intronic
934132765 2:88965405-88965427 CTCTCTGACCAACTGAAATTAGG - Intergenic
934921650 2:98348692-98348714 CTCTCTGACCTAATGCATTTTGG + Intronic
937393368 2:121513097-121513119 TTTTGTGCCCAAATGGAATGAGG - Intronic
937789844 2:125946740-125946762 ATTAGTGAGCAAATGCATTTTGG + Intergenic
940517947 2:154704728-154704750 CCTTGTGACCCAAAGCAGTTAGG - Intronic
941248883 2:163136385-163136407 CTTTGTCACCAACAGAAATTAGG + Intergenic
946123819 2:217541398-217541420 CATAATGACTAAATGCAATTTGG + Intronic
946524697 2:220505873-220505895 CTTTGTAACCACATGAATTTGGG + Intergenic
1168732101 20:93455-93477 CATTTTGACCAACTGCAATTTGG + Intronic
1170039906 20:12028916-12028938 CCTTGTTACCAGAAGCAATTAGG + Intergenic
1170812527 20:19685746-19685768 CTCGCTGACCAACTGCAATTGGG + Intronic
1171007376 20:21479836-21479858 TTTTGTGAGCCAATGAAATTTGG - Intergenic
1171138224 20:22717536-22717558 CCTTGTCCTCAAATGCAATTTGG + Intergenic
1172809332 20:37636305-37636327 CTTTTTGAGCCAATGCAACTGGG + Intergenic
1174677612 20:52373612-52373634 CTTTGTTTCCAAATGCAAAATGG + Intergenic
1176724948 21:10423649-10423671 CTTTGAAAACAAATGAAATTAGG + Intergenic
1177083347 21:16670016-16670038 CTTGGCAACCAAATGCAATGTGG + Intergenic
1177235330 21:18382719-18382741 CCTTGGGACCAAATACATTTTGG - Intronic
1178497090 21:33096266-33096288 CTTACTAACTAAATGCAATTGGG - Intergenic
1178629241 21:34244638-34244660 CTTGGTGACCTACTGCATTTGGG + Intergenic
949756658 3:7419313-7419335 CTCTGTGTCCAAATGTCATTGGG - Intronic
949781056 3:7689033-7689055 ATTTATGTCGAAATGCAATTAGG + Intronic
957604896 3:82384856-82384878 CTTAGTGGCCTAATGCCATTTGG + Intergenic
957892247 3:86375696-86375718 CTAAGTGGCCAAATGTAATTAGG + Intergenic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
958538199 3:95432031-95432053 ATTTGTGACCCAAAGCATTTTGG + Intergenic
964465979 3:156993513-156993535 ATTTGACACCAAATGCAACTTGG - Intronic
964770178 3:160216620-160216642 CTGTGTCACCAAATTCATTTTGG - Intergenic
966142411 3:176771016-176771038 CTTTGAGACCAAGAGCATTTTGG + Intergenic
966373025 3:179268027-179268049 TTTAGTGAACAGATGCAATTTGG + Intergenic
967978982 3:195054190-195054212 CCTTGTGTCCAAATGCAAACAGG + Intergenic
968177157 3:196560810-196560832 CTTTGTGAATAAATTCTATTAGG + Intronic
970112126 4:12650634-12650656 ATCTGTGACCAAATGCACATGGG - Intergenic
970994141 4:22246403-22246425 TTTTGTGACCAAATGTATGTGGG - Intergenic
973701297 4:53539880-53539902 CTCTGTAACCAGCTGCAATTAGG + Intronic
973939638 4:55893615-55893637 TTTTGTCTCCTAATGCAATTAGG - Exonic
977548041 4:98408698-98408720 CTTTCAGAATAAATGCAATTTGG - Intronic
977692164 4:99925402-99925424 CTTTGTGACCAAATGCAATTTGG - Intronic
982964191 4:161881812-161881834 CTTTGTGATCATTTACAATTTGG + Intronic
984284380 4:177710258-177710280 CTTTGGCTCCAAATGCATTTTGG + Intergenic
986403259 5:7399419-7399441 CTTTGTGAACAATATCAATTAGG - Intronic
988011172 5:25488118-25488140 TTTTCTGACCAAATAAAATTGGG + Intergenic
993153765 5:84195481-84195503 GTTTGTGACCTACTTCAATTAGG - Intronic
994050291 5:95355020-95355042 CTTTATGAACAATTGCTATTTGG + Intergenic
995183728 5:109251212-109251234 CTCAGTGACCAAATGCCATCTGG - Intergenic
995244600 5:109921837-109921859 AGTTGTGAGCAAATGCAATGTGG - Intergenic
995878473 5:116817387-116817409 GTATGTCATCAAATGCAATTAGG + Intergenic
996655732 5:125933633-125933655 CTTTCTGACCAACTAAAATTAGG - Intergenic
998653007 5:144142327-144142349 CTTTGTGATCAAATTCTATCTGG + Intergenic
1000458178 5:161479195-161479217 CTTTGTGCCCAAAGACACTTTGG - Intronic
1004389265 6:15196513-15196535 ATTTGTGAATAAAAGCAATTTGG + Intergenic
1008253382 6:49267873-49267895 CTTTCTGACCAAGTGTAGTTTGG - Intergenic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1010034949 6:71314072-71314094 CTTTGAGACCGAAGGCTATTGGG - Intergenic
1011877877 6:91984353-91984375 CTTTGTCACTGAATGTAATTTGG + Intergenic
1012556180 6:100515018-100515040 CTTTAAAACCAAATGCAAATTGG - Intronic
1012766658 6:103375567-103375589 CTTGGTGACAAGATGCTATTTGG + Intergenic
1013006106 6:106075055-106075077 CTTTCTTATCCAATGCAATTGGG - Intergenic
1013426731 6:110019051-110019073 GTTTGTAATCAAATGCATTTGGG - Intergenic
1013504567 6:110786942-110786964 CATTGTGTGCAAATGCAGTTTGG - Intronic
1016173576 6:141050544-141050566 CTTTGGGACCAAATGCTGGTGGG - Intergenic
1016434845 6:144025335-144025357 CTTTGTGACTAAATGTAATGAGG + Intronic
1016546512 6:145229937-145229959 ATTTGTGCCCAAAAGCAAATGGG - Intergenic
1018337426 6:162808758-162808780 ATTTGTGGGAAAATGCAATTAGG - Intronic
1023540692 7:41262200-41262222 CTTTTTGACAAATTCCAATTTGG + Intergenic
1024245242 7:47464748-47464770 CCTTGTCACCACATGCAATGCGG + Intronic
1026128542 7:67600986-67601008 CTCTGTGCACAAAAGCAATTTGG + Intergenic
1026410111 7:70111530-70111552 CCTTGTGACCATTTGCAAATTGG + Intronic
1028220209 7:88188358-88188380 CTGCATGACTAAATGCAATTTGG + Intronic
1029506278 7:100965777-100965799 CTGTGTCACCAAATGCACGTCGG + Exonic
1030093111 7:105875308-105875330 ATCTGTGACCAAATGCAAAGTGG + Intronic
1030408420 7:109143772-109143794 CTTAGAGACCAAAAGCACTTTGG + Intergenic
1030410747 7:109176581-109176603 CATTGTCACCAAATAGAATTGGG + Intergenic
1030611656 7:111696544-111696566 CTTTGAAACCAAATCCCATTTGG - Intergenic
1032000562 7:128262523-128262545 CTTTGTACCCAAATGCAAAGGGG - Intergenic
1032514081 7:132494227-132494249 CTTTGTGACCAAATGTCTATCGG - Intronic
1032552416 7:132796898-132796920 CTTTGTGACCAAGTGGATATGGG - Intronic
1034612851 7:152387769-152387791 CTTTGAAAACAAATGGAATTAGG - Intronic
1037869933 8:22484477-22484499 CTTTCTGACAAAATGGAATAAGG + Intronic
1038377312 8:27054427-27054449 CTTTGTTACCTAGTGCAATTTGG - Intergenic
1042971115 8:74409874-74409896 CTTTCTGACCAACTAAAATTTGG - Intronic
1043565253 8:81540625-81540647 CATGATGACCAAATGCAATGTGG + Intergenic
1046307515 8:112389161-112389183 CTTTTTGACCCACTGCAATGTGG - Intronic
1048053204 8:130838874-130838896 CAATGTGACCAAATGCAATGTGG + Intronic
1050003010 9:1098602-1098624 CTTTGAGAACAATTGCCATTGGG + Intergenic
1050118243 9:2282358-2282380 CCTTTTTATCAAATGCAATTAGG + Intergenic
1051098758 9:13497099-13497121 CATGGTGACCAAATCCAATGTGG + Intergenic
1051800560 9:20928724-20928746 CTTTGTAACCAAAGGCTTTTAGG + Intronic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1055122744 9:72681479-72681501 ATTTGTGAGAAACTGCAATTAGG - Intronic
1055395631 9:75870944-75870966 CTTTGTGACTCAATTCATTTTGG - Intergenic
1056037947 9:82628891-82628913 CTTTGTGATCAAAGGTAATTGGG - Intergenic
1056388132 9:86116275-86116297 GTTTGAGACCAAACACAATTTGG - Intergenic
1059913579 9:119074219-119074241 ATGTGTGACCAAATGCTATCAGG + Intergenic
1061536928 9:131256064-131256086 CTCTGTGACTAAATGCCACTTGG + Intergenic
1186864429 X:13705419-13705441 CATTCTGACCAAATGAATTTGGG - Intronic
1187839389 X:23471172-23471194 CTTACTGGCCAAATGCAATGAGG - Intergenic
1188080591 X:25834922-25834944 CTTTGTGACCAAAACCCATCAGG - Intergenic
1188913136 X:35875315-35875337 ATTTTTCAACAAATGCAATTTGG - Intergenic
1189545470 X:42037875-42037897 CTTTGTTACAAACTGCCATTTGG - Intergenic
1191949467 X:66572557-66572579 CTTAGTGACCAAGAGCACTTTGG + Intergenic
1193665944 X:84316754-84316776 CTCTGAGTCCAAATGTAATTGGG + Intergenic
1193958003 X:87886393-87886415 CTTAGTGACGAAAAGCACTTTGG + Intergenic
1194792714 X:98170603-98170625 CTTTGAGATCAAATGCCATTTGG - Intergenic
1194995385 X:100586563-100586585 CTTTGGGACTAAATGAAAGTGGG - Intronic
1195828873 X:109033320-109033342 CTTAGAGACCAAAAGCACTTTGG + Intergenic
1198088737 X:133306321-133306343 CATAGTGACTAAATGCAGTTTGG - Intronic
1198641600 X:138761883-138761905 CTCTGTCACCACCTGCAATTAGG - Intronic
1199866701 X:151856992-151857014 ATTTATGACCAATTGAAATTTGG + Intergenic