ID: 977693725

View in Genome Browser
Species Human (GRCh38)
Location 4:99946044-99946066
Sequence TAGGGGCCTAGGCCTTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977693720_977693725 -5 Left 977693720 4:99946026-99946048 CCATTCCTCTCACTTCGATAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 977693725 4:99946044-99946066 TAGGGGCCTAGGCCTTATGTAGG 0: 1
1: 0
2: 0
3: 0
4: 47
977693718_977693725 8 Left 977693718 4:99946013-99946035 CCACTAGAGTACACCATTCCTCT 0: 1
1: 0
2: 2
3: 5
4: 120
Right 977693725 4:99946044-99946066 TAGGGGCCTAGGCCTTATGTAGG 0: 1
1: 0
2: 0
3: 0
4: 47
977693723_977693725 -10 Left 977693723 4:99946031-99946053 CCTCTCACTTCGATAGGGGCCTA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 977693725 4:99946044-99946066 TAGGGGCCTAGGCCTTATGTAGG 0: 1
1: 0
2: 0
3: 0
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977693725 Original CRISPR TAGGGGCCTAGGCCTTATGT AGG Intronic
901148972 1:7087752-7087774 TACTGCCCTAGGACTTATGTGGG - Intronic
912812470 1:112804506-112804528 TAGCAGCCTAGGCCTCAAGTTGG - Intergenic
913453817 1:119010619-119010641 TAGGAGCCAAGGCATCATGTAGG + Intergenic
914743631 1:150485430-150485452 TAGAGGCAAAGGGCTTATGTAGG + Intergenic
918139165 1:181705798-181705820 TATGAGCCTAGGGTTTATGTGGG + Intronic
918339170 1:183553053-183553075 CAGGGGCCTGGGCCCTCTGTGGG - Exonic
919743495 1:200994422-200994444 GAGGGGCCTAGGTTTTCTGTTGG - Intronic
919901287 1:202046096-202046118 TAGGGGCAGAGGCCTTGGGTAGG - Intergenic
919901499 1:202047103-202047125 TAGGGGCAGAGGCCTTGGGTGGG + Intergenic
919905185 1:202073602-202073624 AAGGGGGCTAGGCCTCATGCTGG + Intergenic
923750645 1:236743291-236743313 AAGGAGGCCAGGCCTTATGTAGG - Intronic
1073248428 10:102107475-102107497 TGGGGGCCTAGGGCCTAGGTGGG - Intergenic
1083757723 11:64800611-64800633 CAGGGGCCTGGTCCTTCTGTGGG - Intronic
1092853073 12:12648180-12648202 TAGGGGCAGAGCCCTCATGTAGG - Intergenic
1093520032 12:20038811-20038833 TGGGTGCCATGGCCTTATGTAGG + Intergenic
1097399704 12:59114142-59114164 CAGGTGCCTAGGCCTCCTGTAGG + Intergenic
1100135823 12:91552214-91552236 TAGCGGGCTAGGCCTTGTGAGGG + Intergenic
1116727574 14:48580504-48580526 TATGGTCCTAGGACTTTTGTAGG + Intergenic
1117665697 14:58053571-58053593 CAGGGGCCTTGGCCTGATGGGGG - Intronic
1131835347 15:96384596-96384618 TAGAGGTCTAGGGCTTATTTGGG + Intergenic
1138754286 16:59464497-59464519 TGGGGGACTCGGCATTATGTGGG + Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1148135723 17:45290466-45290488 TAGGGGCCTAGGGTTGTTGTGGG - Intronic
1149865238 17:60147960-60147982 TAGGGGACAAGGCCTGATTTAGG - Intergenic
1153424283 18:4945355-4945377 AAAGGGCCTAGTCGTTATGTTGG + Intergenic
1154258941 18:12811900-12811922 TAGGGTTCTAGGCATTGTGTGGG - Intronic
1161975875 19:7607582-7607604 TGGGGGCCTGGGTCTTTTGTGGG + Intronic
1167954545 19:53054117-53054139 TTGGTGCCTAAGCCGTATGTTGG + Intergenic
929909237 2:46074954-46074976 TAGAGGGCAAGGCATTATGTGGG + Intronic
935456206 2:103270223-103270245 TAGGGGGCTAGGCTTGATGAGGG - Intergenic
938615314 2:132991706-132991728 CAGGGGCCTAAGCTTTACGTGGG + Intronic
1172859239 20:38034148-38034170 GAGGGGCCTAGGTTGTATGTGGG - Intronic
951104151 3:18723743-18723765 TGGGGGCCTAGGCCTCAGGAAGG - Intergenic
952210103 3:31221968-31221990 CAGGAGCCTGGGCCTCATGTGGG + Intergenic
952210555 3:31225466-31225488 CAGGAGCCTGGGCCTTGTGTGGG + Intergenic
952267592 3:31801542-31801564 CAGGGGCCTGGGCCTGCTGTGGG - Intronic
960619073 3:119621883-119621905 AAGGGAGCTAGGCCTAATGTTGG - Intronic
961965586 3:130898773-130898795 TAGGGGCCCAGGACTGATTTTGG + Intronic
973948950 4:55990806-55990828 TAGGGGGCTGGGCGTTATGGTGG - Intronic
977693725 4:99946044-99946066 TAGGGGCCTAGGCCTTATGTAGG + Intronic
985946694 5:3190887-3190909 TAGGGCCCTAGGCCTTCCCTAGG + Intergenic
1007585283 6:42985240-42985262 GAGGGGCCTAGGCCAGATTTGGG - Intronic
1010875440 6:81099176-81099198 TATGGCCCTATGCCATATGTTGG + Intergenic
1011361274 6:86527258-86527280 TAGATGCCTATGCCTTATGGTGG - Intergenic
1046620354 8:116522678-116522700 AACAGGCCTAGGCCATATGTAGG - Intergenic
1055112632 9:72574891-72574913 TAGGAGCCTAAGCTTTATGGTGG - Intronic
1189967619 X:46390858-46390880 TAGGGGCATGGGACTTTTGTGGG + Intergenic
1199999530 X:153051205-153051227 TGGGGGCCCTGGCCTTCTGTTGG + Intergenic