ID: 977693960

View in Genome Browser
Species Human (GRCh38)
Location 4:99946864-99946886
Sequence CGGCGCCAGCAGGCTCGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977693951_977693960 20 Left 977693951 4:99946821-99946843 CCTCCTGGGCCGGGGCGTCCGAG 0: 1
1: 1
2: 0
3: 8
4: 139
Right 977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG 0: 1
1: 0
2: 1
3: 3
4: 73
977693952_977693960 17 Left 977693952 4:99946824-99946846 CCTGGGCCGGGGCGTCCGAGCTG 0: 1
1: 0
2: 1
3: 18
4: 187
Right 977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG 0: 1
1: 0
2: 1
3: 3
4: 73
977693956_977693960 2 Left 977693956 4:99946839-99946861 CCGAGCTGACTCGGTGGTCCGCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG 0: 1
1: 0
2: 1
3: 3
4: 73
977693953_977693960 11 Left 977693953 4:99946830-99946852 CCGGGGCGTCCGAGCTGACTCGG 0: 1
1: 0
2: 0
3: 4
4: 103
Right 977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG 0: 1
1: 0
2: 1
3: 3
4: 73
977693946_977693960 30 Left 977693946 4:99946811-99946833 CCAGGACCAACCTCCTGGGCCGG 0: 1
1: 0
2: 2
3: 13
4: 163
Right 977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG 0: 1
1: 0
2: 1
3: 3
4: 73
977693950_977693960 24 Left 977693950 4:99946817-99946839 CCAACCTCCTGGGCCGGGGCGTC 0: 1
1: 1
2: 1
3: 14
4: 188
Right 977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG 0: 1
1: 0
2: 1
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977693960 Original CRISPR CGGCGCCAGCAGGCTCGAAG CGG Intergenic
900160891 1:1223265-1223287 CGACGCCATCAGGCTCAACGAGG - Exonic
906318004 1:44800496-44800518 CGGCGGCCGCACGCTGGAAGGGG - Exonic
910428006 1:87134740-87134762 AGGAGCCAGCAGCCTCGGAGAGG + Intronic
917444116 1:175092288-175092310 AGGCTCCAGCAGGCTGTAAGAGG - Intronic
921378513 1:214499927-214499949 CTGTGCCAGCAGGCTTGAGGAGG + Intronic
1063645300 10:7875537-7875559 CAGAGCCAGCGGGCACGAAGGGG + Intronic
1064091290 10:12387902-12387924 GGGCGCCAGCAGGGGCGAAAGGG - Intronic
1065911440 10:30309611-30309633 CGGCACCAGGAGGCTCTAAAGGG + Intergenic
1070575281 10:77672821-77672843 CGGAGACCGCAGGCTCCAAGAGG - Intergenic
1077884984 11:6380740-6380762 AGGGGCCAGCAGGCAAGAAGAGG + Intergenic
1079008630 11:16810494-16810516 CTGCACCAGCAGCCTGGAAGAGG - Intronic
1079035262 11:17014641-17014663 CGGTGCCAGCAGGCTGGGGGCGG - Intergenic
1083213919 11:61206718-61206740 TGGCTCCAGCAGGCTTGAGGTGG - Intronic
1083216803 11:61225547-61225569 TGGCTCCAGCAGGCTTGAGGTGG - Intronic
1083219685 11:61244373-61244395 TGGCTCCAGCAGGCTTGAGGTGG - Intronic
1092905964 12:13101133-13101155 CGGCGCCAGCAGGCCGGCTGGGG + Intronic
1094753357 12:33439123-33439145 CGGCGCCGGGAGGCGGGAAGCGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097664917 12:62467213-62467235 CGGCACCAGCAGCCCCGAGGCGG + Exonic
1100424830 12:94474733-94474755 AGGTGCCAGCAGGCAGGAAGAGG - Intergenic
1102248373 12:111369126-111369148 CGGCGCGAGCAGGCTGGGAAGGG - Intergenic
1102603483 12:114051167-114051189 CAGAGCCAGCAGGCTAGAATTGG - Intergenic
1103348379 12:120265824-120265846 CGGGGCCAGCAAGCTCGCGGGGG - Intergenic
1108484571 13:50910527-50910549 GGGATCCAGTAGGCTCGAAGTGG + Intronic
1119435489 14:74595316-74595338 CGGCTCCAGCAGGCATGAGGAGG + Intronic
1119667677 14:76496835-76496857 CGCAGCCAGCAGGCTCCCAGGGG - Intronic
1125034399 15:35107109-35107131 CTGTGCCAGCAGGCTTTAAGAGG + Intergenic
1127846761 15:62877250-62877272 CGGCTCCAGCAGCCTCTTAGCGG - Intergenic
1128547613 15:68578767-68578789 TGGCGTCCGCAGGCCCGAAGGGG + Intergenic
1131985984 15:98043385-98043407 CGGGGTCAGCAGGCTCCAAGAGG - Intergenic
1132401049 15:101505715-101505737 CAGCTCCATCAGGCACGAAGAGG + Intronic
1140478717 16:75251408-75251430 AGGCGGCAGCGGGCTGGAAGGGG - Intronic
1142351649 16:89583462-89583484 CGGCGCCAGCAGTCGCCCAGGGG - Exonic
1203081492 16_KI270728v1_random:1147979-1148001 CGGCGCCCGCAGTCTGCAAGCGG + Intergenic
1146484842 17:33234653-33234675 AGGCACCAGCAGGTTGGAAGAGG + Intronic
1148830068 17:50425693-50425715 TGGCGCCAGCGGGCCCGCAGGGG + Intergenic
1151708437 17:75785113-75785135 CGGCCCCAGCAGGTTGGAACCGG - Intronic
1153805258 18:8705159-8705181 CGGCGCCGGCTGGCTGGAGGCGG + Intergenic
1154291391 18:13110939-13110961 AGCTGCCAGCAGGCTAGAAGAGG - Intronic
1154358720 18:13642008-13642030 CGGCGCCAGCGGGGCGGAAGCGG - Intronic
1160627672 18:80223742-80223764 CGGCACCAGCAGGCACTCAGTGG + Intronic
1160898171 19:1412547-1412569 CGGGGCCAGCAGCCTCAATGGGG - Intronic
1161379809 19:3958973-3958995 CAGCGCCACCAGGCTGGAGGCGG - Exonic
1161694353 19:5757789-5757811 CGGAGCCAGCAGGCAGGACGGGG - Intronic
1164929706 19:32165985-32166007 CTGCCCCAGCAGGCTCGATGGGG + Intergenic
1165956041 19:39502818-39502840 GCGCGCCAGCAGGCTCCAGGCGG - Exonic
1166676697 19:44745549-44745571 CGGAGCCAGCAGGGACCAAGGGG - Intergenic
1167439629 19:49500760-49500782 CGGCACCGGCAGGCCCCAAGGGG - Intergenic
1167578948 19:50330931-50330953 CGGCGCCTGCGGGAGCGAAGGGG + Intronic
1167622736 19:50568299-50568321 CGGCGCCGGCGGGCCCGAGGAGG - Intergenic
929867875 2:45733845-45733867 AGGGGCCAGCAGGCCCCAAGTGG - Intronic
936278716 2:111120754-111120776 CGGCGCGTGCAGGCTCGGACAGG - Intronic
946411257 2:219516306-219516328 TGGCGCCAGCAGTCTCCAAATGG - Intronic
947716055 2:232339361-232339383 CGCCGCCAGGAGGCAGGAAGTGG + Intronic
1175152858 20:56948729-56948751 AGGCGCCAGCAGGTTCAATGAGG - Intergenic
1175338174 20:58210049-58210071 CGACGCCGGCAGGCCCGGAGAGG + Intergenic
1175948294 20:62568923-62568945 CGGGGCCAGCAGGCATCAAGAGG - Intronic
1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG + Intergenic
1184291940 22:43502066-43502088 CGGCTCCAGGAGGCTGGCAGCGG + Intronic
956468705 3:69542815-69542837 CGGTGCCAGGAGGCGCGGAGCGG + Intergenic
977693960 4:99946864-99946886 CGGCGCCAGCAGGCTCGAAGCGG + Intergenic
998929028 5:147159864-147159886 CTGCTCTACCAGGCTCGAAGAGG + Intergenic
999317611 5:150594345-150594367 CAGAGCCAGGAGGCTGGAAGAGG + Intergenic
1010352334 6:74888984-74889006 AGGCGGCAGCAGGCTGGAGGAGG - Intergenic
1016345689 6:143111752-143111774 CTGGGCCAGCAGCCTGGAAGTGG + Intronic
1019061844 6:169262824-169262846 CGGGGGCAGGAGGCTCGGAGGGG - Intergenic
1019300064 7:298356-298378 CTGCACCAGCAGGCTCTGAGAGG - Intergenic
1020030472 7:4929320-4929342 CGGCCGCAGCAGCCTCGCAGGGG + Intronic
1025256147 7:57385060-57385082 AGGCCCCAGGAGGCTCCAAGAGG - Intergenic
1032130521 7:129224462-129224484 CGGCGGCTCCAGGCTGGAAGTGG - Intergenic
1037473756 8:19237085-19237107 CGACGCCAGCAGCCTCCAATCGG + Intergenic
1038041378 8:23726925-23726947 CGGCGCCACCCGGCTGGGAGCGG - Intergenic
1055574644 9:77648627-77648649 AGGCGGCAGCAGGCTGGAAGAGG + Intergenic
1060059611 9:120447422-120447444 CAGAGCCAGCAGGTTCAAAGAGG + Intronic
1062319676 9:135984649-135984671 CGGCACCAGGAGGACCGAAGGGG - Intergenic
1062581549 9:137231188-137231210 CGGGGCCAGGAGCCTTGAAGTGG + Intronic
1193152522 X:78139827-78139849 AGGCCCCAGCAGGCTCCATGGGG - Intergenic
1198378824 X:136065193-136065215 CGGCGACAGGAGGCTGGGAGGGG - Intergenic