ID: 977701726

View in Genome Browser
Species Human (GRCh38)
Location 4:100029868-100029890
Sequence GCCTGTTACTGGGTTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977701726_977701734 26 Left 977701726 4:100029868-100029890 CCCACCAAAACCCAGTAACAGGC No data
Right 977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG No data
977701726_977701733 22 Left 977701726 4:100029868-100029890 CCCACCAAAACCCAGTAACAGGC No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701726_977701731 -2 Left 977701726 4:100029868-100029890 CCCACCAAAACCCAGTAACAGGC No data
Right 977701731 4:100029889-100029911 GCCAAGAGCTGTCACTCAAAAGG No data
977701726_977701735 27 Left 977701726 4:100029868-100029890 CCCACCAAAACCCAGTAACAGGC No data
Right 977701735 4:100029918-100029940 GTTATCTACAGAAGTTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977701726 Original CRISPR GCCTGTTACTGGGTTTTGGT GGG (reversed) Intergenic
No off target data available for this crispr