ID: 977701728

View in Genome Browser
Species Human (GRCh38)
Location 4:100029872-100029894
Sequence CTTGGCCTGTTACTGGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977701728_977701733 18 Left 977701728 4:100029872-100029894 CCAAAACCCAGTAACAGGCCAAG No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701728_977701734 22 Left 977701728 4:100029872-100029894 CCAAAACCCAGTAACAGGCCAAG No data
Right 977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG No data
977701728_977701735 23 Left 977701728 4:100029872-100029894 CCAAAACCCAGTAACAGGCCAAG No data
Right 977701735 4:100029918-100029940 GTTATCTACAGAAGTTGGCAGGG No data
977701728_977701731 -6 Left 977701728 4:100029872-100029894 CCAAAACCCAGTAACAGGCCAAG No data
Right 977701731 4:100029889-100029911 GCCAAGAGCTGTCACTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977701728 Original CRISPR CTTGGCCTGTTACTGGGTTT TGG (reversed) Intergenic
No off target data available for this crispr