ID: 977701732

View in Genome Browser
Species Human (GRCh38)
Location 4:100029890-100029912
Sequence TCCTTTTGAGTGACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977701732_977701733 0 Left 977701732 4:100029890-100029912 CCAAGAGCTGTCACTCAAAAGGA No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701732_977701735 5 Left 977701732 4:100029890-100029912 CCAAGAGCTGTCACTCAAAAGGA No data
Right 977701735 4:100029918-100029940 GTTATCTACAGAAGTTGGCAGGG No data
977701732_977701736 24 Left 977701732 4:100029890-100029912 CCAAGAGCTGTCACTCAAAAGGA No data
Right 977701736 4:100029937-100029959 AGGGCCTTGCTCCAAAATCCTGG 0: 15
1: 5
2: 9
3: 32
4: 359
977701732_977701734 4 Left 977701732 4:100029890-100029912 CCAAGAGCTGTCACTCAAAAGGA No data
Right 977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977701732 Original CRISPR TCCTTTTGAGTGACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr