ID: 977701733

View in Genome Browser
Species Human (GRCh38)
Location 4:100029913-100029935
Sequence GAGTAGTTATCTACAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977701726_977701733 22 Left 977701726 4:100029868-100029890 CCCACCAAAACCCAGTAACAGGC No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701727_977701733 21 Left 977701727 4:100029869-100029891 CCACCAAAACCCAGTAACAGGCC No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701732_977701733 0 Left 977701732 4:100029890-100029912 CCAAGAGCTGTCACTCAAAAGGA No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701728_977701733 18 Left 977701728 4:100029872-100029894 CCAAAACCCAGTAACAGGCCAAG No data
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701730_977701733 11 Left 977701730 4:100029879-100029901 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data
977701729_977701733 12 Left 977701729 4:100029878-100029900 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 977701733 4:100029913-100029935 GAGTAGTTATCTACAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977701733 Original CRISPR GAGTAGTTATCTACAGAAGT TGG Intergenic
No off target data available for this crispr