ID: 977701736

View in Genome Browser
Species Human (GRCh38)
Location 4:100029937-100029959
Sequence AGGGCCTTGCTCCAAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 15, 1: 5, 2: 9, 3: 32, 4: 359}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977701732_977701736 24 Left 977701732 4:100029890-100029912 CCAAGAGCTGTCACTCAAAAGGA No data
Right 977701736 4:100029937-100029959 AGGGCCTTGCTCCAAAATCCTGG 0: 15
1: 5
2: 9
3: 32
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977701736 Original CRISPR AGGGCCTTGCTCCAAAATCC TGG Intergenic
900225346 1:1530504-1530526 AGGGTCTTGCTCTGTAATCCAGG - Intronic
900459114 1:2792040-2792062 AGGGTCTTGCTCCATCACCCAGG + Intronic
900689947 1:3974477-3974499 AGGGCCTTGCTCCATCACCCAGG - Intergenic
900744846 1:4354042-4354064 CTGGCCTTCCTCCAAACTCCAGG - Intergenic
900861332 1:5234502-5234524 AGGGCCCTGCACCAAAGCCCTGG + Intergenic
901019093 1:6246923-6246945 AGGTCCTTCCTCCAAACTCCAGG + Intergenic
901069939 1:6512033-6512055 AGGCCCTTGGTCCAGAGTCCTGG - Intronic
901802490 1:11716587-11716609 AGGGTCTCGCTCCATCATCCAGG - Intronic
904360050 1:29965364-29965386 AGGATCTGGCTCCCAAATCCAGG + Intergenic
904372988 1:30062354-30062376 AGGGCTTTGCACCAAAAAACTGG - Intergenic
905349985 1:37338841-37338863 AGGGCTTTGCTCCCAAGTCCAGG - Intergenic
905421629 1:37850031-37850053 ATGGGCTGGTTCCAAAATCCTGG - Intronic
906701021 1:47858281-47858303 AGGGTCTTGCTCCATCACCCAGG + Intronic
907370570 1:54000505-54000527 AGGGTCTTGCTCCATTACCCAGG + Intergenic
907817678 1:57936415-57936437 AGAGTCTTGCTCCATCATCCAGG + Intronic
908459291 1:64333741-64333763 AGGGTCTTGCTCTATCATCCAGG + Intergenic
910658441 1:89643115-89643137 AGGGCCTTGCTCTGTCATCCTGG + Intronic
911733451 1:101312706-101312728 AGAGTCTTGCTCCTAAATGCTGG + Intergenic
912212249 1:107568872-107568894 AGGGTCTTGCTCCAAAATCCTGG - Intergenic
914768874 1:150665350-150665372 GGGGTCTTGCTCCATTATCCAGG + Intronic
915388284 1:155517305-155517327 AGGGTCTTGCTCCGTCATCCAGG - Intronic
916061166 1:161099392-161099414 GCGGCCCTGCTCCAAACTCCTGG + Exonic
917052491 1:170939859-170939881 AAGGCTTTGCTCCAAAATCCTGG + Intronic
917487936 1:175472110-175472132 AGGGTCTTGCTCCATCATCCAGG - Intronic
918069158 1:181122370-181122392 AGGGCCCTGCTCCAGGCTCCTGG - Intergenic
918958240 1:191237927-191237949 AGGGCCTTGCTCCAAAATCCTGG - Intergenic
919103114 1:193117790-193117812 AGGGTCTTGCTCTGTAATCCAGG - Intergenic
920157496 1:203966737-203966759 AGAGTCTTGCTCCATCATCCAGG - Intergenic
923518460 1:234717448-234717470 AGGGCCTTGGTACAAAATCTAGG + Intergenic
1063272270 10:4523753-4523775 ATGGTCTTACACCAAAATCCTGG - Intergenic
1063543396 10:6957050-6957072 AGGGCCTTGCTCTGAATTCTGGG - Intergenic
1064441180 10:15355110-15355132 AGGGTCTTGCTCTGACATCCAGG + Intronic
1064624877 10:17251888-17251910 ATGGCCTTCCTTCAGAATCCAGG + Intergenic
1065298444 10:24299209-24299231 GGGGCCAGGCTCTAAAATCCAGG + Intronic
1065634127 10:27712909-27712931 AGGGCCTTGCTCTGTCATCCAGG - Intronic
1065827447 10:29584923-29584945 AGGGTCTTGCTCCATCACCCAGG + Intronic
1065971541 10:30809829-30809851 AGCGTCTTGCTCCATCATCCAGG - Intergenic
1066387342 10:34952428-34952450 AGGGTCTTGCTCCAACGCCCAGG + Intergenic
1067300793 10:45006965-45006987 AGGACCTTCCTCCAATTTCCTGG + Intergenic
1069520967 10:69120889-69120911 AGGGTCTTGCTCCACCATCCAGG + Intergenic
1070344330 10:75526831-75526853 AGGGCCTTGCTCTGCCATCCAGG - Intronic
1071682200 10:87717586-87717608 AGGGTCTTGCTCCATCACCCAGG + Intronic
1071937685 10:90549254-90549276 AGGGCCTTGCTCCAAAATCCTGG - Intergenic
1072054956 10:91745689-91745711 AGGGCCTTGCTCTATCACCCAGG - Intergenic
1072237237 10:93463837-93463859 AGGGTCTTGCTCTAACACCCAGG - Intronic
1072251932 10:93588709-93588731 AGGGTCTTGCTCCAATGCCCAGG + Exonic
1072303806 10:94087464-94087486 AGGGTCTTGCTCTGACATCCAGG + Intronic
1072530180 10:96311667-96311689 AGGGCCTTGCTCTATCACCCAGG + Intronic
1074576065 10:114670521-114670543 AGGGTCTTGCTCCCTCATCCAGG + Intronic
1075439970 10:122472420-122472442 AGGGTCTTGCTCCATCACCCAGG + Intronic
1075746121 10:124728932-124728954 AGAGCCTGGCTTGAAAATCCAGG - Intronic
1075931183 10:126297522-126297544 AGGGCCTTGCTCCCTCACCCAGG - Intronic
1076527757 10:131123161-131123183 CGGGCCCTGCTCCAAACCCCAGG + Intronic
1077208446 11:1355458-1355480 AGGGTCTTGCTCCATCACCCGGG + Intergenic
1078061413 11:8047592-8047614 AGGGCCTTCCTCCTAGATTCAGG + Intronic
1078225550 11:9388502-9388524 AGGGTCTTGCTCCATCACCCAGG + Intronic
1079912134 11:26323686-26323708 AGGTCCTTACTCCATAATTCTGG - Intronic
1081673612 11:44955526-44955548 AGGACCTTGAACCTAAATCCAGG - Intergenic
1083120511 11:60508215-60508237 AAGGCCTTGCTGCTAGATCCAGG + Intergenic
1083784482 11:64935926-64935948 AGGGCGTGGCTCCAAAATGCTGG - Intergenic
1084664465 11:70569116-70569138 GGGGCCTTCCTGCAGAATCCAGG - Intronic
1085317323 11:75553474-75553496 ACAGCCTTGCTCCAATAACCTGG + Intergenic
1086472870 11:87134506-87134528 AGGGTCTTGCTCTATCATCCAGG + Intronic
1087858574 11:103124418-103124440 AGGGTATTGCTCCAACACCCAGG - Intronic
1088317571 11:108522906-108522928 AGGGACTTGCTCCATCACCCAGG + Intronic
1089395190 11:118132057-118132079 AGGGCCTTGGTACAAAAGCTGGG - Intergenic
1089814374 11:121159302-121159324 ACAGCCTTGGTCCAGAATCCAGG + Intronic
1090477522 11:127037117-127037139 AGGGCCTTGCTCCCTGATCCTGG - Intergenic
1091175068 11:133550427-133550449 AGGGTCATGTTACAAAATCCAGG + Intergenic
1091440399 12:508294-508316 AGGGTCTTGCTCCATCACCCAGG + Intronic
1092299763 12:7235688-7235710 AGGCCCAGCCTCCAAAATCCTGG - Intergenic
1092965742 12:13640223-13640245 AGGGCCTTGCTCTGTCATCCAGG - Intronic
1093048929 12:14485015-14485037 AGGGCCTTGCTCCAAAATCCTGG + Intronic
1093049675 12:14491010-14491032 AGGGCTTTGCTCCAAAGTCCTGG + Intronic
1094151973 12:27294736-27294758 AGGGTCTTGCTCCATCACCCAGG + Intronic
1095305460 12:40633720-40633742 AGGGTCTTGCTCTATCATCCTGG + Intergenic
1095844404 12:46730015-46730037 AGGGCCTTGCTCCAAAATAGAGG + Intergenic
1095856245 12:46863722-46863744 AGGGACTTGCTCAAAAATCCTGG + Intergenic
1095930111 12:47617273-47617295 AGGTCTTTGCTCCTAAACCCAGG + Intergenic
1096171149 12:49471362-49471384 AGAGCCTTGCTCCATCAACCAGG + Intronic
1096287858 12:50315809-50315831 AGGGCCTTGCTCTATCACCCAGG + Intergenic
1096503150 12:52077574-52077596 AGGGCATTGCTCCAAGATGAGGG + Intergenic
1098673036 12:73254197-73254219 AGGGCCTTGCTCCAAAATCCTGG - Intergenic
1100395451 12:94182390-94182412 AGGGTCTTGCTCCATCACCCAGG - Intronic
1100552295 12:95656201-95656223 AGAGCCTTGCTCCATTACCCAGG - Intergenic
1101328597 12:103738999-103739021 AGGGCCTTGCTCTGTCATCCAGG + Intronic
1101384603 12:104245621-104245643 AGGGTCTTGCTCCAACACCCAGG - Intronic
1101853757 12:108425272-108425294 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1102428375 12:112862377-112862399 AGGGCCTTGCTCTGCCATCCAGG - Intronic
1103765706 12:123278004-123278026 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1103849023 12:123919099-123919121 AGGGTCTTGCTCCATCACCCAGG + Intronic
1104360115 12:128125072-128125094 AGGGCCTTTCACCAAGATCCAGG + Intergenic
1105884802 13:24632557-24632579 AGGGCTCTGCACCAAAAACCTGG + Intergenic
1106054799 13:26228223-26228245 ATGGCCTTGCTCCAGGATCCTGG + Intergenic
1106110047 13:26768932-26768954 AGGGCCTTGCACCCACACCCTGG - Intergenic
1106166067 13:27247575-27247597 GGGGCCTAGCTCCAAGACCCAGG + Intergenic
1106222362 13:27757072-27757094 AGGGCCTTGCTCTGTCATCCAGG + Intergenic
1107273352 13:38646879-38646901 AGGGTCTTGCTCTATAACCCAGG - Intergenic
1107364274 13:39653778-39653800 AGGGCCTTGCTCCATCACCCAGG + Intergenic
1108081634 13:46743060-46743082 AGGGCCTTGTTCCAAGGTCAAGG + Intronic
1108914307 13:55588918-55588940 AGGGCTTTGCTACAAAATCCTGG + Intergenic
1110751202 13:79118610-79118632 AGGGCTTTGTTTCAAACTCCTGG - Intergenic
1111317497 13:86581756-86581778 AGGGCCTTGCTCCAATATTCTGG - Intergenic
1112360972 13:98718343-98718365 AGGGTCTTGCTCTATCATCCAGG + Intronic
1113564148 13:111308526-111308548 AGGGCCTTCCTGCTAACTCCTGG + Intergenic
1113679654 13:112234467-112234489 CGGGCATTGCTCAAAGATCCTGG - Intergenic
1114623878 14:24115791-24115813 AGTGCCTTGATCCCAACTCCAGG + Intronic
1115735828 14:36328741-36328763 AGGGTCTTGCTCTACAACCCAGG + Intergenic
1116531458 14:45978272-45978294 AGGAACTTGCTCAAAAATCCTGG + Intergenic
1118675963 14:68184582-68184604 AGGGCCTTGCTCTATCACCCTGG - Intronic
1119088564 14:71759501-71759523 AGGGTCTTGCTCCATCATCCAGG + Intergenic
1119583853 14:75813233-75813255 AGGGTCTTGCTCTATTATCCAGG + Intronic
1119818178 14:77589950-77589972 AGGGTCTTGCTCTATCATCCAGG - Intronic
1120401126 14:84033305-84033327 AGGGCCTTGCTCCATCACCCAGG - Intergenic
1120925828 14:89796330-89796352 AGGGTCTTGCTCTATCATCCAGG + Exonic
1121275814 14:92666921-92666943 AGGGCCTGGCTCCTAACCCCAGG + Intronic
1121344123 14:93122560-93122582 AGGGCCTTGCTCTGTAACCCAGG - Intergenic
1122954301 14:105062950-105062972 AGGGTCTTGCTCCCTCATCCAGG + Intronic
1122964300 14:105114377-105114399 AGAGTCTTGCTCTATAATCCAGG - Intergenic
1124425556 15:29559747-29559769 AGGGCCTGCCTACATAATCCAGG + Intronic
1125783265 15:42290780-42290802 AGGGTCTTGCTCCATCACCCAGG - Intronic
1126148693 15:45502409-45502431 AGGGTCTTGCTCCATCACCCAGG + Intronic
1128103483 15:65025641-65025663 AGCTGCTTGCACCAAAATCCTGG - Intronic
1128187905 15:65659357-65659379 AGGGTCTTGCTCTGTAATCCAGG + Exonic
1128630403 15:69260283-69260305 AGAGTCTTGCTCCATCATCCAGG + Intronic
1128735507 15:70051636-70051658 AAGGCCTTTCTCTGAAATCCAGG + Intronic
1130072099 15:80656387-80656409 ATGGCCTTGCTCCAGAACCCTGG + Intergenic
1130088644 15:80800573-80800595 TGGGACTTTTTCCAAAATCCAGG + Intronic
1131368667 15:91861658-91861680 AGGGTCTTGCTCTATCATCCAGG + Intronic
1131477530 15:92752981-92753003 AGGGTCTTGCTCCATCACCCAGG - Intronic
1131844339 15:96472565-96472587 AGGGTCTTGCTCCATCAGCCAGG - Intergenic
1132696296 16:1203602-1203624 AGGCCAGTGCTCCAAAATCCAGG + Intronic
1133003633 16:2865077-2865099 GGGGCATTGCTCAAACATCCAGG + Intergenic
1133004554 16:2871778-2871800 AGGGCCTCACTCCATTATCCAGG - Intergenic
1133104424 16:3497647-3497669 AGGGCCTTGCTCCATTGCCCAGG + Intergenic
1133719771 16:8484052-8484074 AGAGCCCTGCTACAAAGTCCAGG - Intergenic
1133791857 16:9015258-9015280 AGAGCCTTACTCCATCATCCAGG + Intergenic
1136170164 16:28484372-28484394 AGGGTCTTTCTCCAGCATCCAGG + Intronic
1136473980 16:30500573-30500595 AGGGCCTTGCTCTATCGTCCAGG + Intronic
1137543447 16:49380454-49380476 AATGTCTGGCTCCAAAATCCTGG + Intronic
1137637316 16:49998079-49998101 AGGGTCTTGCTCTGATATCCAGG - Intergenic
1137991794 16:53164551-53164573 AGGGCCTTGCTCTATCACCCAGG - Intronic
1138274136 16:55718988-55719010 AGGGGCTTCCTCCAAGGTCCAGG + Intergenic
1138470318 16:57229591-57229613 AGGGTCTTGCTCCATTACCCAGG - Intronic
1138485697 16:57341733-57341755 TGGGACTTGCTCGGAAATCCAGG + Intergenic
1139557509 16:67721865-67721887 AGGGCCTTGCTCTGTCATCCAGG + Intergenic
1139587560 16:67913928-67913950 ACAGCCATGCTCCAAATTCCAGG - Intronic
1139607394 16:68029470-68029492 AGAGTCTTGCTCCAATTTCCAGG + Intronic
1139689757 16:68633059-68633081 AGGGTCTTACTCCATCATCCAGG + Intergenic
1139764708 16:69217445-69217467 AGGGTCTTGCTCTATTATCCAGG - Intronic
1140326957 16:74013724-74013746 AGGGTCTTGCTCTATAACCCAGG + Intergenic
1140703165 16:77601470-77601492 AGGGCCTTGCTCTGTCATCCAGG - Intergenic
1140796794 16:78445850-78445872 AGAGCCTTGCTCCATCACCCAGG - Intronic
1140999382 16:80294333-80294355 AGGGCCTTGCTGCCACTTCCTGG - Intergenic
1141504841 16:84469508-84469530 AGGGTCTTGCTCTATTATCCAGG - Intergenic
1141529642 16:84637353-84637375 AGGGCTTTTCCCCAAAATCACGG + Intergenic
1144118768 17:12128731-12128753 AAGGCCTTGGTCCATAATCGTGG - Intronic
1144257682 17:13485845-13485867 AGGGTCTTACTCCAATGTCCAGG - Intergenic
1144874085 17:18387985-18388007 AGGGTCTTGCTCCATCACCCAGG - Intronic
1146836350 17:36113953-36113975 AGGGACTTGCTCCAAAATCCTGG - Intergenic
1146908488 17:36632980-36633002 AGGGCGTTGTTCCCAATTCCTGG + Intergenic
1148220284 17:45856617-45856639 AGGGTCTTGCTCAGTAATCCAGG + Intergenic
1148223704 17:45883227-45883249 ATGGCCTTGCTCCAGAACCCTGG + Intergenic
1149215061 17:54345033-54345055 AGGGCCTTGCTGCTAAAACAGGG + Intergenic
1149328082 17:55553684-55553706 AAGGTCTTGCTCCATCATCCAGG + Intergenic
1149588067 17:57806873-57806895 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1149751850 17:59154123-59154145 AGGCGCTTCCTCCAAAGTCCAGG + Intronic
1150158977 17:62878019-62878041 AGGGCCTTGCTCTGTCATCCAGG - Intergenic
1150474105 17:65461239-65461261 AGGGCCTTGCTCCATTGCCCAGG + Intergenic
1150641254 17:66951325-66951347 AGGGCCTTGCTCCATCACCCAGG + Intergenic
1151792920 17:76320805-76320827 AGGGTCTTGCTCTATAACCCAGG + Intronic
1152495508 17:80668501-80668523 AGGTCCTTTCTCCAGAAGCCTGG - Intronic
1152577202 17:81147727-81147749 AGGGTCTTGCTCCATCACCCAGG - Intronic
1152764251 17:82127494-82127516 AGGGCTTTGCACCATAACCCGGG + Intronic
1152818069 17:82420501-82420523 AGGCCCTAAGTCCAAAATCCAGG - Intronic
1153066207 18:1047887-1047909 ATGTCCTAACTCCAAAATCCCGG - Intergenic
1153328547 18:3848100-3848122 GGGGCCTTGCTCCATCATCCAGG - Intronic
1153752809 18:8250761-8250783 AGGGTCTTTCTCCATCATCCAGG - Intronic
1156151741 18:34251196-34251218 AGGACCCTGCTCCAACATCAAGG + Intergenic
1157277367 18:46321050-46321072 TGAGCCTTGCTCTTAAATCCTGG - Intergenic
1157553414 18:48597020-48597042 TGGGCCCTGCCCCAAATTCCTGG + Intronic
1157788909 18:50512522-50512544 AGGGTCTTGTTCCATCATCCAGG + Intergenic
1159293496 18:66451983-66452005 AGAGTTTTGCTCCAAAATCCTGG + Intergenic
1159512843 18:69418484-69418506 AGGGCCTTGCTCTGTCATCCAGG + Intronic
1161116219 19:2498084-2498106 AGGGTCTTGCTCCATAGCCCAGG + Intergenic
1161719271 19:5894241-5894263 AGGCCCTGTCTCCAAATTCCTGG - Intronic
1162545445 19:11326353-11326375 AGGGTCTTGCTCCATCACCCAGG - Intronic
1162878548 19:13639192-13639214 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1163243628 19:16078662-16078684 ACGGTCTTGCTCCTAAATCTTGG - Intronic
1163273647 19:16269018-16269040 AGGACCCTCCTCCAAAAGCCAGG + Intergenic
1163441984 19:17326958-17326980 AGGGTCTTGCTCCATCACCCAGG + Intronic
1164141261 19:22466549-22466571 GGGGTCTTGCTACACAATCCAGG + Intronic
1164302326 19:23972883-23972905 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1164437373 19:28242588-28242610 AGAGCCATCCTCCAAAATTCTGG + Intergenic
1165336727 19:35175744-35175766 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1165855236 19:38876083-38876105 AGGGTCTTGCTCCATCACCCAGG + Intronic
1165984433 19:39755522-39755544 AGTGTCTTGGGCCAAAATCCCGG + Intergenic
1166829211 19:45628514-45628536 TGGGCCTTGATTCAAAACCCAGG + Intronic
1167241806 19:48348268-48348290 AGGGCTTTGGGCCAAAAACCTGG + Intronic
1167591370 19:50406214-50406236 CGGCCTTTGCTCCAACATCCGGG + Exonic
1167625125 19:50582984-50583006 AGGGCCTTACTCCTAAAGCATGG - Intergenic
1167688955 19:50973801-50973823 AGGGTCTTGCTCTATCATCCAGG - Intergenic
1167702385 19:51057491-51057513 AGGGCCTTGCTCTATCACCCAGG + Intronic
1168603079 19:57735738-57735760 AGAGTCTTGCTCCATCATCCAGG - Intronic
925405295 2:3602105-3602127 AGAGCCCTGCTACAAAAGCCAGG - Intronic
925699792 2:6624831-6624853 AGGGTCTTGCCCCATCATCCAGG - Intergenic
926147464 2:10405374-10405396 AGGGCATGGCTCCAAGACCCTGG + Intronic
926810401 2:16750726-16750748 AGGGTCTTGCTTCAAAATCCTGG + Intergenic
929269830 2:39960829-39960851 AGGGCCTTGCTCCAAAATCCTGG + Intergenic
929982223 2:46692221-46692243 AGGGTCTTGCTCCATCACCCAGG + Intergenic
930260432 2:49140157-49140179 AGGCCCTAGCTCCAAAATTGGGG - Intronic
932735941 2:74254839-74254861 AGGGTCTTGCTCCATCACCCAGG + Intronic
933065660 2:77792335-77792357 AGGGCCTTGCTCTGTCATCCAGG + Intergenic
935268960 2:101417228-101417250 AGGGTCTTGCTCCATCACCCAGG + Intronic
935614873 2:105067851-105067873 AGGGTCTTGCTCCATCAACCAGG + Intronic
936806747 2:116342415-116342437 AGGGCAATGATCCAAAATCCAGG - Intergenic
939521348 2:143234737-143234759 AGGACCTTGCTCCATTATTCTGG + Intronic
940278878 2:151968750-151968772 AGGGCCATATTCTAAAATCCTGG + Intronic
940645642 2:156389813-156389835 AGAGTCTTGCTCCATCATCCAGG - Intergenic
940735934 2:157452377-157452399 AGGGTCTTGCTCCATCACCCAGG - Intronic
940917863 2:159276977-159276999 AGGGTCTTGCTCCGTCATCCAGG - Intronic
941775099 2:169384893-169384915 AGGGTCTTGCTCCATTGTCCAGG + Intergenic
941914378 2:170800271-170800293 AGGGTCTTGCTCCATCACCCAGG + Intergenic
942384919 2:175432385-175432407 AGCTCCATGCTCCAAAATTCAGG - Intergenic
943517603 2:188907291-188907313 AGGGCCTTGCTCCAAAATCCTGG + Intergenic
943999483 2:194814490-194814512 AGGGCCTTGCTCTATCACCCAGG + Intergenic
946703779 2:222437841-222437863 AGGGCCTTGCTCCAAAATCCTGG + Intronic
946814102 2:223558177-223558199 AGGGTCTTGCTCTATAACCCAGG + Intergenic
947387458 2:229605864-229605886 AGGGTCTTGCTCCATCACCCAGG - Intronic
947833304 2:233157260-233157282 GGGGCCTTACTTCATAATCCAGG - Intronic
948985592 2:241520723-241520745 AGGGTCTTTCTCCATCATCCAGG - Intergenic
1169018952 20:2314308-2314330 AGGGTCTTGCTCTATAACCCAGG - Intronic
1169113881 20:3050163-3050185 ATGGCCTTGCTCAAAACACCAGG + Intergenic
1169962167 20:11173020-11173042 AGGTCCTTGGTCCAAATCCCAGG + Intergenic
1170203478 20:13770392-13770414 AGGGTCTTGCTCCATCACCCAGG + Intronic
1170724253 20:18912128-18912150 AGGGTCTTGCTCTATCATCCAGG + Intergenic
1170903946 20:20494608-20494630 TGGGCCGTGCTCCAGAGTCCCGG + Intronic
1171181171 20:23091737-23091759 AGGGCCTGGCTCCATCTTCCAGG - Intergenic
1171299454 20:24047597-24047619 AGGGCCTTGCTCTCTCATCCAGG + Intergenic
1172259379 20:33548935-33548957 AGGGTCTTGCTCTATCATCCAGG - Intronic
1172296469 20:33814678-33814700 AGGGTCTTGCTCTGACATCCAGG + Intronic
1172439962 20:34958372-34958394 GGTGCTTTCCTCCAAAATCCTGG + Intergenic
1174751313 20:53114066-53114088 AGGGTCTTGCTCCATTACCCAGG - Intronic
1175437718 20:58966088-58966110 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1175534672 20:59700813-59700835 AGGGGCTTGCTCCATCATCTAGG + Intronic
1175653550 20:60749685-60749707 ATGGCCTTGCTCCAGCCTCCAGG - Intergenic
1176078141 20:63258457-63258479 AGAACCTTGCCCCAAACTCCTGG + Intronic
1177248886 21:18567323-18567345 GGAGCCTTGCTACAAAATCAGGG + Intergenic
1178012655 21:28305126-28305148 AGGGCCTTGCTCCAAAATCCTGG - Intergenic
1179913726 21:44463143-44463165 AGGGCCTCGCTGCAGAAGCCAGG + Intergenic
1180795899 22:18605188-18605210 TGGGCCTTGCTCCTCAGTCCTGG + Intergenic
1181225825 22:21390083-21390105 TGGGCCTTGCTCCTCAGTCCTGG - Intergenic
1181252808 22:21544730-21544752 TGGGCCTTGCTCCTCAGTCCTGG + Intergenic
1181420648 22:22795782-22795804 AGGGCCTTGCTCCAAAATCCTGG - Intronic
1182938991 22:34255536-34255558 AGGGCCTTGCATCCCAATCCTGG - Intergenic
1184571393 22:45327212-45327234 AGGGCCTTGCTCTGTCATCCAGG - Intronic
949952278 3:9239013-9239035 AGGGTTGTGCTCCAAGATCCAGG - Intronic
951970768 3:28441915-28441937 AGGGCCTTGCTCCAAAATCCTGG + Intronic
953156946 3:40384278-40384300 AGGGTCTTGCTCTATAGTCCAGG + Intergenic
953951864 3:47197432-47197454 AGGGCCTTGCTCTATCACCCAGG - Intergenic
954179536 3:48870842-48870864 AGGGTCTTACTCTATAATCCAGG + Intronic
955105487 3:55893607-55893629 AGGGCCTTGGACCAAAATGGTGG - Intronic
955215208 3:56979554-56979576 AGGGCCTTGCTCACAGACCCCGG - Intronic
955972212 3:64446618-64446640 AGGGTCTTGCTCTAACACCCAGG - Intergenic
956084696 3:65597290-65597312 AGCCCCTCGCTCCAAAAGCCCGG + Intronic
956491452 3:69776382-69776404 AGGGCCTGGCTTCTGAATCCTGG + Intronic
958881993 3:99682390-99682412 AGGGCCTTGCTCTGTCATCCAGG - Intronic
959515340 3:107260028-107260050 AGGGTCTTGCTCCATCACCCAGG - Intergenic
959536992 3:107497754-107497776 AGGGGCTTTCTCCAATATCAGGG - Intergenic
961262843 3:125616373-125616395 AGGGCCTTGCTCCAAAGTCCTGG - Intergenic
961340481 3:126213839-126213861 AGGGCTTTGCTCCAAAGTGCTGG - Intergenic
966612108 3:181877903-181877925 AAGGTCTTGCTCCATAACCCAGG - Intergenic
968090813 3:195897184-195897206 CTGGCCTTGCTCCAGAAGCCTGG - Intronic
969416455 4:7063118-7063140 AGGGTCTTGCTCTATCATCCAGG + Intronic
970514777 4:16817518-16817540 AGGGCTTTGCTCTACATTCCAGG - Intronic
971181343 4:24330987-24331009 ATGCCCTTCCTCCAAATTCCTGG + Intergenic
971354794 4:25885714-25885736 AGGGTCTTGCTCCATCACCCAGG - Intronic
971454753 4:26833961-26833983 AGGCCCTTCCTCCAACATCGGGG - Intergenic
972410303 4:38786835-38786857 AGGGCCTTGGTCCCTGATCCAGG + Intergenic
973260643 4:48159966-48159988 AGGCCCCTGCTCCAAAATTGGGG + Intronic
975636349 4:76453302-76453324 AGGGTCTTGCTCCATTGTCCAGG + Intronic
977701736 4:100029937-100029959 AGGGCCTTGCTCCAAAATCCTGG + Intergenic
977819110 4:101451591-101451613 GGCAGCTTGCTCCAAAATCCAGG + Intronic
979928365 4:126596442-126596464 AGGGTCTTGCTCCATTAGCCAGG - Intergenic
980275924 4:130650596-130650618 AGGGTCTTGCTCTACCATCCAGG - Intergenic
980497530 4:133605412-133605434 AGGGCCTTGCTCCAAAATCCTGG + Intergenic
981593609 4:146393164-146393186 AGGGCCTTGCTCTGTCATCCAGG - Intronic
986195059 5:5530810-5530832 AGGATCTTGCTCCATCATCCAGG + Intergenic
986962322 5:13230146-13230168 AGGGTCTTGCTCTATCATCCAGG - Intergenic
987033858 5:14000306-14000328 CGGGCCTTGCTCCCAGCTCCTGG - Intergenic
987622553 5:20354438-20354460 AGGGTCTTCCTCCAACACCCCGG + Intronic
988056573 5:26105317-26105339 AGGGCATTGCTCCAAAACCCTGG + Intergenic
988562125 5:32290798-32290820 AGGGCCTTGCTCCAAAATCCTGG - Intronic
988919080 5:35924290-35924312 AGTGACTTGCTCAAAAGTCCTGG + Intronic
990219639 5:53573612-53573634 AGGGCCTTGCTCTGTCATCCAGG + Intronic
990979074 5:61585579-61585601 AGGGTCTTGCTCTATAACCCAGG + Intergenic
991478046 5:67044538-67044560 AGGGTCTTGCTCTATAGTCCAGG + Intronic
991697572 5:69287593-69287615 AGGGTCTTGCTCCATCACCCAGG + Intronic
991971045 5:72141918-72141940 AGTTCCTTGCTCCAAGATGCAGG - Intronic
992474203 5:77086911-77086933 GGGGCCTTGCCACAGAATCCCGG + Intronic
992919009 5:81493308-81493330 AGGGTCTTGCTCCATTGTCCAGG + Intronic
993363160 5:87002854-87002876 ATGGCCTTGCTCCTGAACCCTGG + Intergenic
993498302 5:88633077-88633099 AGGGTCTTGCTCTATCATCCAGG - Intergenic
993884535 5:93400144-93400166 ATGGCCTTGTTCTAAAAGCCAGG - Intergenic
993933506 5:93972071-93972093 AAGGCCATGCTCATAAATCCTGG - Intronic
995157068 5:108928150-108928172 AGGTGCTTGCTCCCAAATGCAGG + Intronic
996450963 5:123624433-123624455 AGTGCCTTGCTCCAATAACCAGG + Intergenic
997036366 5:130197081-130197103 TGGCCCTTGCTCCCAAATTCTGG + Intergenic
997166243 5:131662592-131662614 AAGGACTTGCTCCCAAAGCCTGG - Intronic
998513227 5:142730956-142730978 ATGGCCTTGCTCTGGAATCCCGG + Intergenic
999541690 5:152581713-152581735 AGGGCCTTACTCTGAAACCCAGG + Intergenic
1000453100 5:161415511-161415533 ATGGCTTTGGTACAAAATCCTGG - Intronic
1000525843 5:162356514-162356536 AGGCCCTACCTCCAAAATTCAGG + Intergenic
1001078108 5:168644543-168644565 AGAGTCTTGCTCTATAATCCAGG + Intergenic
1001247218 5:170113810-170113832 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1001746351 5:174095561-174095583 AGGGCCTGCCTGCATAATCCAGG + Intronic
1002714508 5:181218055-181218077 AGGGTCTTCCTGCAAAGTCCCGG - Intergenic
1003074967 6:2975193-2975215 AGGGTCTCGCTCCATCATCCAGG - Intergenic
1003571604 6:7259836-7259858 AGGGCCTTGCTACATTGTCCAGG - Intergenic
1004769743 6:18768599-18768621 AGGGCCTTGCTCCATTGCCCAGG - Intergenic
1004893333 6:20122855-20122877 AGAGTCTTGCTCCATCATCCAGG + Intronic
1005722205 6:28614488-28614510 AGGGTCTTGCTCCATCACCCAGG + Intronic
1006062347 6:31433174-31433196 AGGGCCTTGCTCCAAAATCCTGG - Intergenic
1006426421 6:33966066-33966088 AAGGTCTTGCTCCATCATCCAGG + Intergenic
1007208867 6:40175279-40175301 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1010184314 6:73125333-73125355 AGGGCTTTGCTCTCAAATCTAGG - Intronic
1010785273 6:79993245-79993267 AGGGTCTTGCTCCATCATCTAGG - Intergenic
1013406477 6:109848438-109848460 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1014534202 6:122596678-122596700 AGGGCCTTGCTCCAAAATCCTGG + Intronic
1016137370 6:140561139-140561161 ATGACCTTACTCTAAAATCCTGG - Intergenic
1016445500 6:144127705-144127727 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1016794631 6:148104973-148104995 AGGGTCTTGCTCTATAACCCAGG + Intergenic
1018379111 6:163241539-163241561 AGGTCCTTTTTCCAAAACCCTGG - Intronic
1018629409 6:165809369-165809391 AGAGCCTTGCTTCCAAATCTTGG - Intronic
1018660931 6:166086998-166087020 AGGGCTGTGCTCGACAATCCAGG - Intergenic
1022651228 7:32277221-32277243 AGGGTCTTGCTCCATCACCCAGG - Intronic
1022817894 7:33930922-33930944 AGGGTCTTGCTCCATCACCCAGG - Intronic
1023449730 7:40270108-40270130 AGGGTCTTGCTCCATCACCCAGG - Intronic
1024744203 7:52388389-52388411 AGAGCCTTGCTTCAAAATCCTGG - Intergenic
1025614198 7:63104312-63104334 AGGGTCTTGCTCTATCATCCAGG + Intergenic
1025827176 7:65019979-65020001 AGGGCCTTGCTCTATCACCCAGG - Intergenic
1025841353 7:65152674-65152696 AGGGTCTTGCTCCGTCATCCAGG + Intergenic
1025914709 7:65856391-65856413 AGGGCCTTGCTCTATCACCCAGG - Intergenic
1025963481 7:66246034-66246056 AGGGTCTTGCTCCATCACCCAGG + Intronic
1026347155 7:69483899-69483921 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1026474547 7:70723474-70723496 AGGGGCTTTCTGCCAAATCCAGG - Intronic
1026776256 7:73232835-73232857 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1026996137 7:74617931-74617953 AGGGCCTTGCTCTAACACCCAGG + Intergenic
1027017110 7:74786207-74786229 AGGGTCTTGCTCCATCACCCAGG - Intronic
1027070915 7:75159728-75159750 AGGGTCTTGCTCCATTACCCAGG + Intergenic
1027167698 7:75847355-75847377 AGGGTCTTGCTCCATCACCCAGG + Intronic
1027210703 7:76145593-76145615 AGGGTCTTGCTCTATAATCCAGG + Intergenic
1027417925 7:77992027-77992049 AGGACCTGGCTTCTAAATCCAGG + Intergenic
1029667511 7:102005357-102005379 AGGGTCTTGCTCCATCATCCAGG + Intronic
1029813406 7:103071407-103071429 AGGGTCTTGCTCCATCACCCAGG + Intronic
1032845025 7:135744918-135744940 AGGGTCTTGCTCCATCATCCAGG + Intronic
1033058682 7:138084286-138084308 AGGGTCTTGCTCCAACACCCAGG + Intronic
1034986599 7:155519493-155519515 AGGGTCTTGCTCCATCACCCAGG - Intronic
1035522738 8:288121-288143 AGGGTCTTGCTCTAAAACCGAGG - Intergenic
1036254086 8:7190390-7190412 AGGGTCTTGCTCTCAAGTCCAGG + Intergenic
1036363405 8:8097097-8097119 AGGGTCTTGCTCTCAAGTCCAGG - Intergenic
1036571750 8:9985782-9985804 AGGGTCTTGCTCCATCATCCAGG + Intergenic
1036795592 8:11754240-11754262 AGGGCCTTGCTCCACCACCCAGG + Intronic
1037586411 8:20279654-20279676 AGGGTCTTGCTCCATCACCCAGG - Intronic
1041228328 8:55723362-55723384 AGGCTCTTGCTCCATCATCCAGG - Intronic
1041546972 8:59056404-59056426 AGGGCCTTGCTCTATCACCCAGG - Intronic
1042124977 8:65529120-65529142 AGAGACTTGCCCCAAACTCCTGG - Intergenic
1042696978 8:71565002-71565024 AGGGTCTTGCTCCATCTTCCAGG - Intronic
1043072418 8:75655717-75655739 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1043168507 8:76934448-76934470 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1043937048 8:86154653-86154675 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1044487154 8:92767170-92767192 ATGGCCTTGCTCCAAAATCCTGG + Intergenic
1044640950 8:94381098-94381120 AGGGCCTTGCTCTATTGTCCAGG - Intronic
1044657573 8:94564581-94564603 AGGGTCTTGCTCTGAAACCCAGG - Intergenic
1045104799 8:98881959-98881981 AGGGTCTTGCTCCATCACCCAGG - Intronic
1045243448 8:100422514-100422536 AGGGTCTTACTCCAATGTCCAGG + Intergenic
1045625997 8:104051211-104051233 AGGGTCTTGCTGCATTATCCAGG - Intronic
1047978275 8:130153393-130153415 AGGGTCTTGCTCTGACATCCAGG + Intronic
1048418263 8:134250936-134250958 TGGCCCTTCCTCCAAAATGCAGG + Intergenic
1051240007 9:15044321-15044343 AGGGTCTTGCTCTATCATCCAGG + Intergenic
1051245711 9:15108863-15108885 AGGGTCTTGCTCCATCACCCAGG - Intergenic
1051304313 9:15692337-15692359 AGAGTCTTGCTCCATCATCCAGG - Intronic
1052561530 9:30089812-30089834 ATGGCCTTGCTCCAAAACCTAGG + Intergenic
1052863129 9:33448919-33448941 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1055449916 9:76421573-76421595 AGGGCCTTGCTCTCTCATCCAGG - Intronic
1055865347 9:80806783-80806805 AGGGCCTTCTTCCAGAATCTTGG - Intergenic
1056660711 9:88540969-88540991 AGGGTCTTGCACCATCATCCAGG + Intronic
1057141643 9:92729993-92730015 ATGTCCATGCCCCAAAATCCAGG + Intronic
1057620030 9:96626649-96626671 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1058427802 9:104890625-104890647 AGGGTCTTGCTCCATCGTCCAGG + Intronic
1058489531 9:105481796-105481818 AGGGTCTTGCTCCATCACCCAGG + Intronic
1058627474 9:106950024-106950046 AGGGGCTTTCTCCAGCATCCTGG + Intronic
1058721240 9:107766449-107766471 AGGGACTTGCTCTGAAACCCAGG - Intergenic
1059294245 9:113255648-113255670 AGGGTCTTGCTCCATCACCCAGG - Intronic
1059772234 9:117438067-117438089 ACGTCCATGCTCAAAAATCCTGG - Intergenic
1060928723 9:127474291-127474313 AGGGTCTTGCTCCATCACCCAGG + Intronic
1061635318 9:131904424-131904446 AGGGTCTTGCTCCATTACCCAGG + Intronic
1061703484 9:132434111-132434133 AGGGTCTTGCTCCATCACCCAGG - Intronic
1061974272 9:134060564-134060586 AGGGTCTTGCTCTGACATCCAGG - Intronic
1186355653 X:8787246-8787268 AGGGTCTTGCTCTATCATCCAGG - Intergenic
1187520101 X:20005531-20005553 AGGGTCTTGCTCCATTGTCCAGG + Intergenic
1187541306 X:20198395-20198417 AGAGCCTTTCTCCAAATGCCTGG - Intronic
1187823053 X:23308586-23308608 AGGGCCCTTCCCCAAACTCCTGG + Intergenic
1187902534 X:24038085-24038107 AGGGCCTTGCTCTGTCATCCAGG - Intergenic
1189221896 X:39379326-39379348 ATGGCCATGCTCCAAAGTCAAGG + Intergenic
1189419971 X:40848220-40848242 AGGGCCTTGCTCTGTTATCCAGG + Intergenic
1190359223 X:49633740-49633762 AGGGCCTTGCTCTGTTATCCAGG + Intergenic
1191784574 X:64903708-64903730 AGGGGCTAGGTCCAAAAGCCAGG - Intergenic
1193957278 X:87878158-87878180 AGGGCTTTGCTCCAAAATCCTGG - Intergenic
1194143456 X:90234512-90234534 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1195059514 X:101180160-101180182 AGGGTCTTGCTCCACCACCCAGG + Intergenic
1195907691 X:109861908-109861930 AGGGCCTTTCCCCCAAACCCAGG - Intergenic
1197734218 X:129838640-129838662 AGGGCCTTGCCCCATCACCCAGG - Intronic
1197781866 X:130167715-130167737 AGAGTCTTGCTCCATCATCCAGG - Intergenic
1198076447 X:133197894-133197916 AGGGCCTTGCTCTATCACCCAGG - Intergenic
1198809054 X:140516783-140516805 AGGGCCTTGCTCTGTCATCCAGG - Intergenic
1200489210 Y:3803833-3803855 AGGGTCTTGCTCCATCACCCAGG + Intergenic
1201362471 Y:13167931-13167953 AGGGCTTGGCACCAAAAACCAGG - Intergenic
1201559444 Y:15300655-15300677 AGGGCCTCTCTCCACCATCCAGG + Intergenic
1202051782 Y:20789051-20789073 AGGGTCTTGCTCTAGCATCCAGG + Intergenic