ID: 977703050

View in Genome Browser
Species Human (GRCh38)
Location 4:100042309-100042331
Sequence CTCAGTTTTCTCAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977703044_977703050 19 Left 977703044 4:100042267-100042289 CCTAGGAAAGCATAGAAAGTTCT No data
Right 977703050 4:100042309-100042331 CTCAGTTTTCTCAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977703050 Original CRISPR CTCAGTTTTCTCAAGGAAGC AGG Intergenic
No off target data available for this crispr