ID: 977708132

View in Genome Browser
Species Human (GRCh38)
Location 4:100093935-100093957
Sequence GCAAGAGCAAGCAACTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977708127_977708132 25 Left 977708127 4:100093887-100093909 CCTGACACTTCTTAAGTACTTGA No data
Right 977708132 4:100093935-100093957 GCAAGAGCAAGCAACTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977708132 Original CRISPR GCAAGAGCAAGCAACTTTGG GGG Intergenic
No off target data available for this crispr