ID: 977708259

View in Genome Browser
Species Human (GRCh38)
Location 4:100095367-100095389
Sequence TATCCGTTGTATCTATTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977708259_977708263 23 Left 977708259 4:100095367-100095389 CCTTAAAATAGATACAACGGATA No data
Right 977708263 4:100095413-100095435 ACATCAATGGCCACTTTCAAAGG No data
977708259_977708260 10 Left 977708259 4:100095367-100095389 CCTTAAAATAGATACAACGGATA No data
Right 977708260 4:100095400-100095422 ACCCTTTTTAAAAACATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977708259 Original CRISPR TATCCGTTGTATCTATTTTA AGG (reversed) Intergenic
No off target data available for this crispr