ID: 977708753

View in Genome Browser
Species Human (GRCh38)
Location 4:100100420-100100442
Sequence TAGGAAGCACAACCTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977708750_977708753 0 Left 977708750 4:100100397-100100419 CCTCTGATAGCCTTAACACACAC No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708746_977708753 22 Left 977708746 4:100100375-100100397 CCTGAGTTCCCTGTCTTCTAACC No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708752_977708753 -10 Left 977708752 4:100100407-100100429 CCTTAACACACACTAGGAAGCAC No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708745_977708753 25 Left 977708745 4:100100372-100100394 CCACCTGAGTTCCCTGTCTTCTA No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708744_977708753 26 Left 977708744 4:100100371-100100393 CCCACCTGAGTTCCCTGTCTTCT No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708747_977708753 14 Left 977708747 4:100100383-100100405 CCCTGTCTTCTAACCCTCTGATA No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708748_977708753 13 Left 977708748 4:100100384-100100406 CCTGTCTTCTAACCCTCTGATAG No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data
977708749_977708753 1 Left 977708749 4:100100396-100100418 CCCTCTGATAGCCTTAACACACA No data
Right 977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977708753 Original CRISPR TAGGAAGCACAACCTGAAAA TGG Intergenic
No off target data available for this crispr