ID: 977711940

View in Genome Browser
Species Human (GRCh38)
Location 4:100136261-100136283
Sequence GGACATAGCCAAAGTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977711935_977711940 17 Left 977711935 4:100136221-100136243 CCGTATTACTTAGTATAGATTCT No data
Right 977711940 4:100136261-100136283 GGACATAGCCAAAGTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977711940 Original CRISPR GGACATAGCCAAAGTGGTCA AGG Intergenic
No off target data available for this crispr