ID: 977714723 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:100169066-100169088 |
| Sequence | GAAGCATCCTTGTACAGATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977714723_977714726 | 15 | Left | 977714723 | 4:100169066-100169088 | CCTGATCTGTACAAGGATGCTTC | No data | ||
| Right | 977714726 | 4:100169104-100169126 | ATTTGCAAAGGTCCTTTCTAAGG | No data | ||||
| 977714723_977714724 | 3 | Left | 977714723 | 4:100169066-100169088 | CCTGATCTGTACAAGGATGCTTC | No data | ||
| Right | 977714724 | 4:100169092-100169114 | CTGCCTAGTTTTATTTGCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977714723 | Original CRISPR | GAAGCATCCTTGTACAGATC AGG (reversed) | Intergenic | ||