ID: 977714723 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:100169066-100169088 |
Sequence | GAAGCATCCTTGTACAGATC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
977714723_977714726 | 15 | Left | 977714723 | 4:100169066-100169088 | CCTGATCTGTACAAGGATGCTTC | No data | ||
Right | 977714726 | 4:100169104-100169126 | ATTTGCAAAGGTCCTTTCTAAGG | No data | ||||
977714723_977714724 | 3 | Left | 977714723 | 4:100169066-100169088 | CCTGATCTGTACAAGGATGCTTC | No data | ||
Right | 977714724 | 4:100169092-100169114 | CTGCCTAGTTTTATTTGCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
977714723 | Original CRISPR | GAAGCATCCTTGTACAGATC AGG (reversed) | Intergenic | ||