ID: 977714726

View in Genome Browser
Species Human (GRCh38)
Location 4:100169104-100169126
Sequence ATTTGCAAAGGTCCTTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977714723_977714726 15 Left 977714723 4:100169066-100169088 CCTGATCTGTACAAGGATGCTTC No data
Right 977714726 4:100169104-100169126 ATTTGCAAAGGTCCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977714726 Original CRISPR ATTTGCAAAGGTCCTTTCTA AGG Intergenic
No off target data available for this crispr