ID: 977715962

View in Genome Browser
Species Human (GRCh38)
Location 4:100184444-100184466
Sequence CCTCAAATACCACAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977715953_977715962 28 Left 977715953 4:100184393-100184415 CCAGCTGGGTATCCTCTAATCCA No data
Right 977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG No data
977715954_977715962 16 Left 977715954 4:100184405-100184427 CCTCTAATCCAATTCCATTCTGA No data
Right 977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG No data
977715957_977715962 2 Left 977715957 4:100184419-100184441 CCATTCTGACACTACCAGGAGAC No data
Right 977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG No data
977715955_977715962 8 Left 977715955 4:100184413-100184435 CCAATTCCATTCTGACACTACCA No data
Right 977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977715962 Original CRISPR CCTCAAATACCACAGGTAGA GGG Intergenic
No off target data available for this crispr