ID: 977720387

View in Genome Browser
Species Human (GRCh38)
Location 4:100233007-100233029
Sequence TTGGCTTGCTTAGGAAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977720387_977720391 -2 Left 977720387 4:100233007-100233029 CCGGTTTTTCCTAAGCAAGCCAA No data
Right 977720391 4:100233028-100233050 AAACTGAATAATAATGGCATAGG No data
977720387_977720389 -8 Left 977720387 4:100233007-100233029 CCGGTTTTTCCTAAGCAAGCCAA No data
Right 977720389 4:100233022-100233044 CAAGCCAAACTGAATAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977720387 Original CRISPR TTGGCTTGCTTAGGAAAAAC CGG (reversed) Intergenic
No off target data available for this crispr