ID: 977720649

View in Genome Browser
Species Human (GRCh38)
Location 4:100236406-100236428
Sequence TAGGACAATTGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977720649_977720657 30 Left 977720649 4:100236406-100236428 CCTGGGCTTCAGCAATTGTCCTA No data
Right 977720657 4:100236459-100236481 ACCAAACACTGATAGACGAGCGG No data
977720649_977720652 -6 Left 977720649 4:100236406-100236428 CCTGGGCTTCAGCAATTGTCCTA No data
Right 977720652 4:100236423-100236445 GTCCTATCAGTTTGGGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977720649 Original CRISPR TAGGACAATTGCTGAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr