ID: 977721572

View in Genome Browser
Species Human (GRCh38)
Location 4:100245137-100245159
Sequence GAGTGTGGCACACCCGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977721566_977721572 -2 Left 977721566 4:100245116-100245138 CCGAACACATGGAGATTCCTAGA No data
Right 977721572 4:100245137-100245159 GAGTGTGGCACACCCGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977721572 Original CRISPR GAGTGTGGCACACCCGGGGA AGG Intergenic
No off target data available for this crispr