ID: 977723733

View in Genome Browser
Species Human (GRCh38)
Location 4:100270232-100270254
Sequence CCGTACCTGGCCTTGTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977723723_977723733 24 Left 977723723 4:100270185-100270207 CCACCTGTCTCAGCCTCCCAGAG 0: 44
1: 2331
2: 32666
3: 91227
4: 171016
Right 977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG No data
977723724_977723733 21 Left 977723724 4:100270188-100270210 CCTGTCTCAGCCTCCCAGAGTGC 0: 94
1: 5019
2: 76608
3: 195204
4: 244166
Right 977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG No data
977723729_977723733 7 Left 977723729 4:100270202-100270224 CCAGAGTGCTGGGATTACAGACA 0: 121
1: 7029
2: 109657
3: 247084
4: 246861
Right 977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG No data
977723728_977723733 8 Left 977723728 4:100270201-100270223 CCCAGAGTGCTGGGATTACAGAC 0: 257
1: 15308
2: 244607
3: 277899
4: 177315
Right 977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG No data
977723727_977723733 11 Left 977723727 4:100270198-100270220 CCTCCCAGAGTGCTGGGATTACA 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
Right 977723733 4:100270232-100270254 CCGTACCTGGCCTTGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977723733 Original CRISPR CCGTACCTGGCCTTGTGTTT TGG Intergenic
No off target data available for this crispr