ID: 977732611

View in Genome Browser
Species Human (GRCh38)
Location 4:100372327-100372349
Sequence TAGGCAGTAATTTGGCTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977732611_977732616 9 Left 977732611 4:100372327-100372349 CCAGTTAGCCAAATTACTGCCTA No data
Right 977732616 4:100372359-100372381 AAGTATTTATAGTGATGAAATGG No data
977732611_977732617 28 Left 977732611 4:100372327-100372349 CCAGTTAGCCAAATTACTGCCTA No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977732611 Original CRISPR TAGGCAGTAATTTGGCTAAC TGG (reversed) Intergenic
No off target data available for this crispr