ID: 977732612

View in Genome Browser
Species Human (GRCh38)
Location 4:100372335-100372357
Sequence CTTTGGGCTAGGCAGTAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977732612_977732616 1 Left 977732612 4:100372335-100372357 CCAAATTACTGCCTAGCCCAAAG No data
Right 977732616 4:100372359-100372381 AAGTATTTATAGTGATGAAATGG No data
977732612_977732617 20 Left 977732612 4:100372335-100372357 CCAAATTACTGCCTAGCCCAAAG No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977732612 Original CRISPR CTTTGGGCTAGGCAGTAATT TGG (reversed) Intergenic