ID: 977732613

View in Genome Browser
Species Human (GRCh38)
Location 4:100372346-100372368
Sequence ATAAATACTTGCTTTGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977732613_977732616 -10 Left 977732613 4:100372346-100372368 CCTAGCCCAAAGCAAGTATTTAT No data
Right 977732616 4:100372359-100372381 AAGTATTTATAGTGATGAAATGG No data
977732613_977732617 9 Left 977732613 4:100372346-100372368 CCTAGCCCAAAGCAAGTATTTAT No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977732613 Original CRISPR ATAAATACTTGCTTTGGGCT AGG (reversed) Intergenic