ID: 977732615 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:100372352-100372374 |
Sequence | ATCACTATAAATACTTGCTT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
977732615_977732617 | 3 | Left | 977732615 | 4:100372352-100372374 | CCAAAGCAAGTATTTATAGTGAT | No data | ||
Right | 977732617 | 4:100372378-100372400 | ATGGCTCTCTCCATTCAAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
977732615 | Original CRISPR | ATCACTATAAATACTTGCTT TGG (reversed) | Intergenic | ||