ID: 977732615

View in Genome Browser
Species Human (GRCh38)
Location 4:100372352-100372374
Sequence ATCACTATAAATACTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977732615_977732617 3 Left 977732615 4:100372352-100372374 CCAAAGCAAGTATTTATAGTGAT No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977732615 Original CRISPR ATCACTATAAATACTTGCTT TGG (reversed) Intergenic