ID: 977732616 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:100372359-100372381 |
| Sequence | AAGTATTTATAGTGATGAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977732613_977732616 | -10 | Left | 977732613 | 4:100372346-100372368 | CCTAGCCCAAAGCAAGTATTTAT | No data | ||
| Right | 977732616 | 4:100372359-100372381 | AAGTATTTATAGTGATGAAATGG | No data | ||||
| 977732611_977732616 | 9 | Left | 977732611 | 4:100372327-100372349 | CCAGTTAGCCAAATTACTGCCTA | No data | ||
| Right | 977732616 | 4:100372359-100372381 | AAGTATTTATAGTGATGAAATGG | No data | ||||
| 977732612_977732616 | 1 | Left | 977732612 | 4:100372335-100372357 | CCAAATTACTGCCTAGCCCAAAG | No data | ||
| Right | 977732616 | 4:100372359-100372381 | AAGTATTTATAGTGATGAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977732616 | Original CRISPR | AAGTATTTATAGTGATGAAA TGG | Intergenic | ||