ID: 977732616

View in Genome Browser
Species Human (GRCh38)
Location 4:100372359-100372381
Sequence AAGTATTTATAGTGATGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977732613_977732616 -10 Left 977732613 4:100372346-100372368 CCTAGCCCAAAGCAAGTATTTAT No data
Right 977732616 4:100372359-100372381 AAGTATTTATAGTGATGAAATGG No data
977732611_977732616 9 Left 977732611 4:100372327-100372349 CCAGTTAGCCAAATTACTGCCTA No data
Right 977732616 4:100372359-100372381 AAGTATTTATAGTGATGAAATGG No data
977732612_977732616 1 Left 977732612 4:100372335-100372357 CCAAATTACTGCCTAGCCCAAAG No data
Right 977732616 4:100372359-100372381 AAGTATTTATAGTGATGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977732616 Original CRISPR AAGTATTTATAGTGATGAAA TGG Intergenic