ID: 977732617

View in Genome Browser
Species Human (GRCh38)
Location 4:100372378-100372400
Sequence ATGGCTCTCTCCATTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977732614_977732617 4 Left 977732614 4:100372351-100372373 CCCAAAGCAAGTATTTATAGTGA No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data
977732613_977732617 9 Left 977732613 4:100372346-100372368 CCTAGCCCAAAGCAAGTATTTAT No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data
977732612_977732617 20 Left 977732612 4:100372335-100372357 CCAAATTACTGCCTAGCCCAAAG No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data
977732611_977732617 28 Left 977732611 4:100372327-100372349 CCAGTTAGCCAAATTACTGCCTA No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data
977732615_977732617 3 Left 977732615 4:100372352-100372374 CCAAAGCAAGTATTTATAGTGAT No data
Right 977732617 4:100372378-100372400 ATGGCTCTCTCCATTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977732617 Original CRISPR ATGGCTCTCTCCATTCAAAG AGG Intergenic