ID: 977733144

View in Genome Browser
Species Human (GRCh38)
Location 4:100379544-100379566
Sequence TCCTCTGGCTGCCCTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977733144_977733150 -1 Left 977733144 4:100379544-100379566 CCATCAGGAGGGCAGCCAGAGGA No data
Right 977733150 4:100379566-100379588 AGTGAGGGGGAAAACTGCATAGG No data
977733144_977733151 0 Left 977733144 4:100379544-100379566 CCATCAGGAGGGCAGCCAGAGGA No data
Right 977733151 4:100379567-100379589 GTGAGGGGGAAAACTGCATAGGG No data
977733144_977733152 6 Left 977733144 4:100379544-100379566 CCATCAGGAGGGCAGCCAGAGGA No data
Right 977733152 4:100379573-100379595 GGGAAAACTGCATAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977733144 Original CRISPR TCCTCTGGCTGCCCTCCTGA TGG (reversed) Intergenic