ID: 977734327

View in Genome Browser
Species Human (GRCh38)
Location 4:100394664-100394686
Sequence CAAACTGTTTACAGTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977734324_977734327 28 Left 977734324 4:100394613-100394635 CCCAGTTCAGCTCTTCTTCTTGT No data
Right 977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 155
977734325_977734327 27 Left 977734325 4:100394614-100394636 CCAGTTCAGCTCTTCTTCTTGTC No data
Right 977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG 0: 1
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977734327 Original CRISPR CAAACTGTTTACAGTGAGAT AGG Intergenic
901331830 1:8415555-8415577 CAGGCTGTTTACACTGAGAACGG + Intronic
905677246 1:39835351-39835373 AAGCCTGTTTACAGTGAGAGAGG + Intergenic
906842085 1:49150073-49150095 CAAACTGTTTATATAGACATAGG + Intronic
909864250 1:80646741-80646763 CAAGCTGTTAACAGTTACATTGG - Intergenic
910196023 1:84640387-84640409 CAAACTTTTGATAGTGAAATGGG - Intergenic
917988322 1:180345808-180345830 CATACTGTTTACATTGTGGTAGG - Intronic
918135083 1:181664930-181664952 CGAACTGTTGACAATTAGATTGG + Intronic
918391898 1:184074113-184074135 CTAACTGGTTATAGTGGGATAGG + Exonic
920332560 1:205220880-205220902 CAACCCTTTTACACTGAGATTGG - Intergenic
921030269 1:211330065-211330087 CAGTCTGTTTACAGTGACAGTGG + Intronic
921357584 1:214300393-214300415 CAATCTGTTTCAAGTGAAATGGG + Intronic
924426643 1:243957213-243957235 GAAAGTGTGGACAGTGAGATTGG + Intergenic
1062965146 10:1601388-1601410 GAAACCGTTTACTGTGAGAAGGG - Intronic
1064252303 10:13716089-13716111 AAAACTGTTTTCTGTGAAATTGG + Intronic
1067899549 10:50224781-50224803 CAAACAGTTTGCAGTGGGTTGGG - Intronic
1070195956 10:74156600-74156622 CAAAGTGTTTACAGTTAGGTGGG + Intronic
1070864984 10:79703101-79703123 CAAACTGTGCACAGTGGAATAGG - Intergenic
1070878773 10:79841232-79841254 CAAACTGTGCACAGTGGAATAGG - Intergenic
1071631879 10:87225322-87225344 CAAACTGTGCACAGTGGAATAGG - Intergenic
1071645334 10:87357542-87357564 CAAACTGTGCACAGTGGAATAGG - Intergenic
1074092112 10:110270719-110270741 CAAAGTATTTACAGTGAAAGGGG - Intronic
1074803237 10:117023631-117023653 CAATCTTTTTACAGTGGCATAGG - Intronic
1078961469 11:16277496-16277518 CACAGTGTTTACAGTCAGCTTGG - Intronic
1082716189 11:56617142-56617164 CAAACTGTCTACAATCAGGTAGG + Intergenic
1083011446 11:59404159-59404181 AAGATTGTTTAAAGTGAGATAGG + Intergenic
1085453785 11:76654695-76654717 CCAACTGTTTCCAGTGCGATAGG + Intergenic
1086196894 11:84151177-84151199 GAAACTGGTTTCAGTAAGATTGG + Intronic
1087063017 11:94000644-94000666 CAGTCTGTTTACAGTGAAAAGGG - Intergenic
1090763860 11:129860131-129860153 CAAACTGATAAAAGTGAGTTAGG + Intergenic
1091512063 12:1137513-1137535 CTAAATGTTTTAAGTGAGATAGG + Intronic
1094564129 12:31584395-31584417 AAAACTCTTTATAGTGAAATTGG - Intronic
1096579802 12:52577568-52577590 CACACTGTCTACAGGGAGAAGGG - Intergenic
1098203295 12:68079953-68079975 CCAACTGGTTACAGTGTGAAAGG - Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1100504927 12:95210216-95210238 CAAACTATTTTCAGTAAGACAGG + Exonic
1100956245 12:99912278-99912300 TTTACTGTTTACAGTGAGTTTGG + Intronic
1101960870 12:109248935-109248957 CCAACGGTCTACAGAGAGATGGG - Intronic
1103386447 12:120536123-120536145 AAAACTGTTTAGAGTGAGACCGG + Intronic
1107240347 13:38225835-38225857 AATACTGTTTACAGTGACCTGGG - Intergenic
1108337169 13:49456332-49456354 AAGACTGTCTAGAGTGAGATTGG + Intronic
1109370810 13:61417003-61417025 CAAACCCTTTACAGTGAAAATGG + Intronic
1110746638 13:79061565-79061587 GAAACTGTTTAGATTGAGGTAGG + Intergenic
1110811257 13:79812786-79812808 AAAATTGTTTACAGTGCCATTGG + Intergenic
1113054009 13:106248296-106248318 CAAACTTTTTAAAGAAAGATGGG - Intergenic
1113868134 13:113542597-113542619 TAAACTGAGCACAGTGAGATGGG + Intronic
1121111231 14:91314507-91314529 CAAAGTGTTCACAGTCAGCTGGG - Intronic
1121626173 14:95386866-95386888 CAAACTGGTTAAAGTGAAAAAGG + Intergenic
1121987842 14:98525720-98525742 GAAAATGTTTATAGGGAGATTGG - Intergenic
1125230060 15:37444023-37444045 CAAATTGTTTTTAGTGTGATAGG + Intergenic
1126670867 15:51113889-51113911 CAACCTGTTTTCAGTGCCATGGG + Intergenic
1126840261 15:52710691-52710713 CAAACTGTGTACTGTGATAGAGG - Intergenic
1128282054 15:66403940-66403962 CAAAAGGTTTACAGTGAGCTTGG - Intronic
1129409228 15:75339690-75339712 CAACCTATTCACTGTGAGATGGG - Exonic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1130767901 15:86891386-86891408 AAAACACTTTACAGGGAGATGGG - Intronic
1133557245 16:6917237-6917259 CAGACTCTTTGCAGTGAGAGCGG - Intronic
1138353319 16:56358249-56358271 CATGCTGTCTTCAGTGAGATGGG + Intergenic
1138953747 16:61945793-61945815 CAAGCTGTTTACAGGGAACTAGG + Intronic
1139576303 16:67844385-67844407 CAAACTCTTTAGGGTGAGCTGGG - Intronic
1140016349 16:71190211-71190233 CAAAATGTATACAGTGAACTTGG + Intronic
1140646798 16:77039542-77039564 CAAAATGTTTCCAGTAAGGTTGG - Intergenic
1147434147 17:40396802-40396824 CCAACTGATTACAATGAGCTAGG + Intronic
1147811821 17:43176131-43176153 AAAATTGTTTTTAGTGAGATAGG + Intronic
1152499047 17:80695929-80695951 CAAACTCTTCACAGAAAGATGGG - Intronic
1155822766 18:30398758-30398780 CAAACTGAGTATAATGAGATTGG - Intergenic
1156378866 18:36539431-36539453 GAAAGTGTCTAGAGTGAGATGGG + Intronic
1165362139 19:35343384-35343406 AAGACTGTGTGCAGTGAGATGGG - Intronic
1166740074 19:45109313-45109335 CAAGCTGTTCACACTGAGATGGG - Intronic
925824234 2:7831493-7831515 CAAACTGTTCAAGGTGAAATAGG + Intergenic
927480122 2:23447019-23447041 CTAATCGTTTTCAGTGAGATAGG + Intronic
928705921 2:33949738-33949760 CAAAGTTTTTACAGTGAGGTGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930562422 2:52976599-52976621 CAAAGTTTTTAGGGTGAGATGGG + Intergenic
930645628 2:53903987-53904009 GAAAATGTTTACAGTAAAATAGG + Intronic
931511166 2:62996776-62996798 AAAACTGTTTACAGTGTAATTGG - Intronic
933143188 2:78819203-78819225 AAAAGTGTTTACAGTTAGGTTGG - Intergenic
933604981 2:84373365-84373387 CTAACTATTTGCAGTGAGAAAGG - Intergenic
935801461 2:106701201-106701223 AAATCTGTTTACACTGAAATGGG - Intergenic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
942354176 2:175089925-175089947 AAAAAGGTTTACAGTTAGATGGG - Intronic
942524264 2:176836862-176836884 CAGACTGTTGAAACTGAGATGGG + Intergenic
942905638 2:181177271-181177293 TAAAATGTTCACAGTGAAATTGG - Intergenic
946957998 2:224952918-224952940 CTAACTATTTTCAGTTAGATAGG + Intronic
947047080 2:225999837-225999859 CAAACTGCTTACAGTAACTTTGG - Intergenic
948330939 2:237164708-237164730 AAAATTGTTGAAAGTGAGATTGG + Intergenic
1169515760 20:6314402-6314424 CCAACCCTTTACTGTGAGATAGG - Intergenic
1173211094 20:41032359-41032381 TAAAATGTTGACAGTGAGTTAGG + Intronic
1173446488 20:43123306-43123328 GAAAGTGTTTCAAGTGAGATAGG - Intronic
1173563928 20:44025931-44025953 CAAACTGTTTACAGGTTGAGAGG + Intronic
1175598365 20:60253488-60253510 CAAACTGCTTACAGTTAGGCTGG - Intergenic
1176019558 20:62955718-62955740 AAAACTGTTTACAGAGAGCCTGG + Intronic
1176976840 21:15331503-15331525 CAAAATGTTTTCAGTGTGTTAGG - Intergenic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177755164 21:25337685-25337707 CAACCTTTTTACAGTTATATTGG + Intergenic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1183513819 22:38251588-38251610 CAAACTGTTCACAGTGTGTTGGG + Intronic
951109211 3:18782128-18782150 CAAACTGTTTACTGTAACCTAGG - Intergenic
951974188 3:28485211-28485233 GAAACTGGTAACAGAGAGATAGG - Intronic
954176344 3:48848496-48848518 CCAAATGTGTACAGTGAGAAAGG + Intergenic
956352854 3:68357085-68357107 AAAAGAGTTTACAGTGTGATTGG - Intronic
958622874 3:96584116-96584138 TAAACTGTCTAAAATGAGATAGG + Intergenic
959621172 3:108400002-108400024 CAAACTGTTTGTAGTTAGTTTGG + Intronic
960904298 3:122584167-122584189 CTAATTGTTTAAAGTGGGATAGG + Intronic
961861495 3:129919935-129919957 CAAACTGTTTCCTGTGAAAATGG - Intergenic
964226225 3:154406229-154406251 TAAACTTTTTCCAGTGTGATAGG - Intronic
964746644 3:160018721-160018743 TACAGTGTTCACAGTGAGATTGG + Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965476011 3:169156022-169156044 CAAACAGTATACAGGTAGATTGG - Intronic
966094471 3:176182933-176182955 CATTCTGTGTACAGTGAGAAGGG + Intergenic
966429252 3:179814174-179814196 CAAAAGGCTTACAGTGAAATGGG - Intronic
970145423 4:13030825-13030847 CAAAGTGTTTACACTGAGAGAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
974519828 4:62969243-62969265 AAAACTGATAACACTGAGATAGG + Intergenic
976335748 4:83883879-83883901 CAAAATGTTTAAGGTGACATAGG - Intergenic
977162292 4:93650120-93650142 CAGGCTATTTAAAGTGAGATAGG - Intronic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
981777774 4:148389992-148390014 CAAACTGTTTGCAGACTGATAGG + Intronic
987193795 5:15504922-15504944 CAAGCTGTTAACAGTGAAAATGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988438689 5:31207576-31207598 CCAGATGTTTACAGTGTGATAGG - Intronic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989950233 5:50288677-50288699 CAAGATGTTTACAGTTGGATAGG - Intergenic
990104524 5:52241376-52241398 CAAATTATTTTCAGTGATATTGG - Intergenic
993407332 5:87527760-87527782 CAAGCTCTTAACAGTGATATGGG - Intergenic
995752460 5:115467819-115467841 AATAGTGTTTACATTGAGATTGG - Intergenic
1003381895 6:5632352-5632374 CAAACTTTTTGTGGTGAGATGGG + Intronic
1003741644 6:8947155-8947177 CACCCTGTTTATAGGGAGATTGG - Intergenic
1005265193 6:24104987-24105009 CAAACTGTAGACAGTGAAACCGG - Intergenic
1007953503 6:45895044-45895066 CAGACTTTTTCTAGTGAGATAGG - Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1009242743 6:61200729-61200751 CAGACTGTTTACAGAGACACAGG - Intergenic
1009677775 6:66848447-66848469 AAAGGTGTTTACAGGGAGATTGG + Intergenic
1009764471 6:68052939-68052961 CAAATTGTATACAGTCAGTTGGG - Intergenic
1011054875 6:83193771-83193793 AAAGATGTTTACAGTGAGCTGGG - Intronic
1012228842 6:96736895-96736917 CACACTGTGGACAGTGAAATAGG + Intergenic
1013848057 6:114478520-114478542 AAAATTGTTTAGAGTGAGAAGGG + Intergenic
1015363630 6:132371911-132371933 CAAAGAACTTACAGTGAGATTGG - Intronic
1015776550 6:136820699-136820721 TAAACTATTTACAGTGACCTTGG - Intergenic
1017436648 6:154421796-154421818 CAAACTGTATACAGTTATGTAGG + Intronic
1019376523 7:695535-695557 GAAACAGTTTCAAGTGAGATGGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1024171228 7:46789756-46789778 AAAACTGCTTACAGTGTGGTGGG + Intergenic
1024389214 7:48787656-48787678 CAAACTGGTTATACTGGGATTGG + Intergenic
1027657501 7:80948837-80948859 GAAAATGTTTGCAGTTAGATTGG - Intergenic
1028614805 7:92754463-92754485 AAAACTGTTTACAGAAAGAATGG - Intronic
1034374751 7:150632308-150632330 CAAAATGTTTTCAGAGAGCTGGG + Exonic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048803427 8:138216452-138216474 ACAACTGTCTGCAGTGAGATTGG + Intronic
1050549264 9:6735171-6735193 CAAACTGCTTAGTGTGAAATTGG + Intronic
1050659632 9:7869229-7869251 GAATCTGTTTGCAGTGAGATTGG + Intronic
1051287446 9:15511014-15511036 CCAACTGTTTACCGAGAGAGGGG + Exonic
1051302723 9:15670217-15670239 CAAACTGTGTCCACTGAAATGGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057497681 9:95573737-95573759 GACACTGTTGAGAGTGAGATGGG - Intergenic
1058431278 9:104922387-104922409 CAAAGTCTTTACCATGAGATTGG + Intronic
1059671341 9:116495316-116495338 TAAATTGTTTAGACTGAGATTGG - Intronic
1185800144 X:3003166-3003188 AAAACTTTTTAAATTGAGATGGG - Intergenic
1186040369 X:5470726-5470748 CAAAGTGTTTATAGATAGATTGG - Intergenic
1187121813 X:16416263-16416285 GAAATTGTTTACAATCAGATTGG + Intergenic
1188638280 X:32463944-32463966 GAAATTGTTTACAGTGTAATGGG + Intronic
1189720005 X:43906110-43906132 AAAACTGATTACAGAGTGATGGG + Intergenic
1193675234 X:84443371-84443393 CAGTCTGTTTAAAGTGAGTTTGG - Intronic
1194270731 X:91811427-91811449 TAAAATGTTAACAGTGAGATTGG + Intronic
1194646438 X:96464011-96464033 CAAACTAATTACAGTGATATTGG + Intergenic
1195954528 X:110315645-110315667 CACACATTTTACAGTGAGTTTGG - Intronic
1199809793 X:151337923-151337945 AAAACTTTTTACATAGAGATGGG - Intergenic
1200587964 Y:5032860-5032882 TAAAATGTTAACAGTGAGATTGG + Intronic
1200864902 Y:8033232-8033254 CAAACTGTTTACATTGGGCCTGG + Intergenic