ID: 977736593

View in Genome Browser
Species Human (GRCh38)
Location 4:100424530-100424552
Sequence TGCAGTGCGTGCTGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977736593_977736597 3 Left 977736593 4:100424530-100424552 CCCACATCCCAGCACGCACTGCA 0: 1
1: 0
2: 1
3: 16
4: 207
Right 977736597 4:100424556-100424578 TCATGCATTTTTGACATCTGTGG 0: 1
1: 0
2: 0
3: 26
4: 232
977736593_977736598 4 Left 977736593 4:100424530-100424552 CCCACATCCCAGCACGCACTGCA 0: 1
1: 0
2: 1
3: 16
4: 207
Right 977736598 4:100424557-100424579 CATGCATTTTTGACATCTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977736593 Original CRISPR TGCAGTGCGTGCTGGGATGT GGG (reversed) Intronic
900538677 1:3191909-3191931 TCCAGTGCTTCCTGGTATGTGGG - Intronic
902245022 1:15115053-15115075 TGCACTGGGCGCTGGGGTGTGGG - Exonic
904272890 1:29362136-29362158 TGCTGTGGGTGCAGTGATGTTGG - Intergenic
905601071 1:39251961-39251983 AGCAGTGCCAGCTGGGATGCTGG - Intronic
907256400 1:53182403-53182425 TGTGGTGAGTGCTGGGATTTGGG + Intergenic
907475786 1:54704486-54704508 TGCAGTGAGTGGTGCGATCTCGG + Intronic
909845250 1:80385814-80385836 TTTAGTGCATGCTGGGCTGTGGG - Intergenic
912447660 1:109750258-109750280 TGCTGTGTGAGCTGGGGTGTGGG + Exonic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
912706440 1:111918547-111918569 TATAGTGAGTGCTGGGATGGTGG + Intronic
915018985 1:152761761-152761783 TGCAGTGAGTTCTAGGAAGTCGG - Exonic
915918285 1:159954452-159954474 TGCAGTACGTGCGGGGACCTGGG - Intergenic
916887107 1:169080371-169080393 TGCAGTGGGTCCTGGCATGATGG - Intergenic
922247219 1:223812608-223812630 TGCAGTGCGTGGTGCCATCTCGG + Intronic
922865946 1:228861666-228861688 GGCAGTGCCTGCAGGGATGATGG + Intergenic
923220829 1:231891574-231891596 TCCAGTGGGCTCTGGGATGTAGG + Intronic
923367280 1:233275251-233275273 TGGAGTGCGTGGTGAGATCTCGG + Intronic
923797132 1:237168303-237168325 TGCAGGGGGTGCTGGGTTGGGGG + Intronic
1064007039 10:11707119-11707141 TGCAGTGCTCTCTGGGATGAGGG - Intergenic
1067479721 10:46587045-46587067 GGCAGTGGGTGCTGGGGTGTGGG - Intronic
1067570621 10:47368621-47368643 GGCAGGGCGGGCCGGGATGTGGG - Exonic
1067615016 10:47754752-47754774 GGCAGTGGGTGCTGGGGTGTGGG + Intergenic
1067988691 10:51183238-51183260 TGCAGTTAGTGCTGGGTTGTGGG + Intronic
1069857208 10:71447895-71447917 TGCACTGTGTGCTGCTATGTTGG - Intronic
1070765047 10:79051594-79051616 TGCTTTGCATGGTGGGATGTGGG - Intergenic
1071630420 10:87214716-87214738 GGCAGTGGGTGCTGGGGTGTGGG + Intergenic
1073068796 10:100780525-100780547 TACAGTGTGTGCTGGGAGGGAGG + Intronic
1076883850 10:133252418-133252440 TGCAGGGCGGGCTGGGGTGCAGG - Intergenic
1077380828 11:2236570-2236592 TGCAGTCCCTTCAGGGATGTGGG - Intergenic
1077401029 11:2357544-2357566 TGCAGTCCCTCCAGGGATGTGGG - Intergenic
1077545413 11:3167162-3167184 TGCAGAGCCTGCTGGGAAGTGGG - Intergenic
1077560826 11:3259558-3259580 TGGAGTGCGTGATGCGATCTCGG + Intergenic
1077566722 11:3305387-3305409 TGGAGTGCGTGATGCGATCTCGG + Intergenic
1078212580 11:9282325-9282347 TGGAGTGCGTGGTGTGATCTCGG - Exonic
1081443716 11:43108979-43109001 TGCAGTGCTTTCTGAGCTGTGGG - Intergenic
1082098858 11:48154884-48154906 TGGAGTGGGAGCTGGGAAGTGGG + Intronic
1083291305 11:61691736-61691758 CGCAGGGGGTGTTGGGATGTAGG + Intronic
1083612393 11:64010359-64010381 TGGAGTGTTGGCTGGGATGTTGG + Intronic
1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG + Intergenic
1084533794 11:69745345-69745367 TGCAGTGCGTGCTCACATGGGGG - Intergenic
1085488082 11:76885650-76885672 TTCAGTGGGCGCTGGGATGTAGG + Intronic
1089288309 11:117421640-117421662 GGCAGTGTGTGGGGGGATGTGGG + Intergenic
1089344179 11:117779605-117779627 TGCTGTGTGTGGTGGGAGGTTGG - Intronic
1089605108 11:119637279-119637301 TGCTGTGCAGACTGGGATGTGGG + Intronic
1089766560 11:120771774-120771796 TCCAGTGGGTGCAGGTATGTGGG + Intronic
1089969163 11:122678594-122678616 GGCAGTGGGTCCTGGGATGATGG - Intronic
1092018391 12:5179355-5179377 TGCAGTGATTGCTGTGATCTCGG + Intergenic
1092132100 12:6119789-6119811 TGCAGTGAGTGGTGCGATCTTGG - Intronic
1096379664 12:51145513-51145535 TGCAGTGAGTGGTGTGATCTTGG - Intronic
1096612121 12:52809062-52809084 TGCAGTGAGTGCCGGTGTGTTGG + Intronic
1097395120 12:59064014-59064036 TGCAGAGAGTGCTGGAATGGAGG + Intergenic
1097947498 12:65388295-65388317 TGCAGTGTGGGCAGGGGTGTGGG - Intronic
1100978027 12:100142536-100142558 TCCAGTGCGGGCTGGGGTGGAGG + Intronic
1101139897 12:101784376-101784398 TGCAGGGAGGGCAGGGATGTGGG + Intronic
1102015270 12:109644242-109644264 TGCAGAGGATGCTGGGATATAGG - Intergenic
1105602696 13:21901472-21901494 TGGAGAGAGTGCTGGGGTGTTGG + Intergenic
1106303291 13:28488616-28488638 TGCAGTGTGGGCCGGGATGGGGG + Intronic
1106436188 13:29724807-29724829 TGGAGTGCGTGGTGCGATCTTGG - Intergenic
1107021621 13:35757945-35757967 TACAGTGGCTGCTGGGATGGAGG + Intergenic
1112984420 13:105430132-105430154 TGCAGTGAGTGGTGCGATCTCGG + Intergenic
1113584759 13:111457697-111457719 TGCAGCGTGTGCGGGGAGGTAGG + Intergenic
1114065274 14:19054517-19054539 TGCAGCGCGTGTTAGGAGGTTGG - Intergenic
1114096988 14:19345485-19345507 TGCAGCGCGTGTTAGGAGGTTGG + Intergenic
1114451605 14:22830107-22830129 TACAGTGAGTCCTGGGATGAGGG + Exonic
1115761550 14:36582193-36582215 TGCGGTGCGGGGTGGGAGGTAGG - Intronic
1116948729 14:50859486-50859508 GGAAGTGCATGCTGGGATGGGGG + Intronic
1117292582 14:54347871-54347893 TGCTTTGCGTGCTGGGAGCTGGG - Intergenic
1120249537 14:82045942-82045964 TTCAGTGTCTGCTGGGCTGTGGG + Intergenic
1121825963 14:97009670-97009692 TGCAGTGCTTGCATGGATGAGGG + Intergenic
1122794122 14:104197165-104197187 TGAAGTGGGGGCTGGGATGCTGG + Intergenic
1123863207 15:24488643-24488665 TTCTGTGCCTGCTGGGATCTGGG + Intergenic
1125148066 15:36495808-36495830 GGCAGTGTGTGCTAGGCTGTCGG + Intergenic
1125683053 15:41544865-41544887 GGGCGTGGGTGCTGGGATGTGGG - Intergenic
1125764418 15:42123639-42123661 TGCACTGGGTCCTGGGATGAGGG - Intergenic
1125870888 15:43100782-43100804 TGGAGTGCGTGGTGCGATCTCGG - Intronic
1126625968 15:50686351-50686373 TGCAGTTCGTTCTGGGGTGAGGG - Intronic
1127709410 15:61580556-61580578 TGGAGTGCGTGGTGTGATCTTGG - Intergenic
1127913404 15:63436671-63436693 TGCAATGCCTCCTGGGATGGTGG - Intergenic
1131796111 15:96018320-96018342 TGCAGTGAGTTTTGGCATGTGGG - Intergenic
1135744477 16:25004371-25004393 TACAGTGAGTGCTTGGATGGAGG - Intronic
1136716700 16:32288021-32288043 TGCAGTGGGTATGGGGATGTCGG + Intergenic
1136835077 16:33494266-33494288 TGCAGTGGGTATGGGGATGTCGG + Intergenic
1137799439 16:51248606-51248628 TGCAGTGCAGGTTGGGATCTCGG + Intergenic
1140187595 16:72788596-72788618 TGCAGTGGGAGCTGTGGTGTGGG + Exonic
1140351253 16:74263810-74263832 TGAAGTGTGTGCAGGGATTTGGG + Intergenic
1141148252 16:81547051-81547073 GGCAGTCTGGGCTGGGATGTGGG + Intronic
1141206128 16:81934363-81934385 TGCAGGGCGAGCTGGGAAGATGG + Intronic
1203009726 16_KI270728v1_random:229766-229788 TGCAGTGGGTATGGGGATGTCGG - Intergenic
1203145249 16_KI270728v1_random:1794587-1794609 TGCAGTGGGTATGGGGATGTCGG + Intergenic
1143972714 17:10807083-10807105 AGCAGTGCCTGCTGGCATGGAGG - Intergenic
1144278191 17:13697692-13697714 TGCAGTGCTTGCTTGGTAGTGGG + Intergenic
1144386232 17:14751391-14751413 TGCAGAGCTTGCAGGGATGGGGG - Intergenic
1145750947 17:27354436-27354458 AGCAGTGGGTGCTGGGAAGCCGG - Intergenic
1146952915 17:36919094-36919116 TGCAGCTCGTGATGGGGTGTGGG + Intergenic
1147761914 17:42803884-42803906 TGGAGTGCCTGGTGGGATCTTGG + Intronic
1148354074 17:46963492-46963514 TGGAGTGCGTGGTGTGATCTTGG - Intronic
1148598418 17:48875587-48875609 TGCAGTGAGTGGTGCGATCTTGG - Intergenic
1151612548 17:75185706-75185728 TGCAGTGAGTGGTGTGATCTTGG - Intergenic
1152015663 17:77748779-77748801 GGCAGTGCGTGCAGGCATGTGGG + Intergenic
1155177123 18:23310587-23310609 TGCAGTGAGAGGTGGGATGTAGG + Intronic
1155233041 18:23793139-23793161 TTCAGTGGGTGCTGGGACATAGG + Intronic
1156980275 18:43278504-43278526 TTCAGTGTGTGCTGGGATGTGGG + Intergenic
1159953148 18:74499819-74499841 TGCAGTGCTGGCTGGGAGGGTGG + Intronic
1160460122 18:79032770-79032792 TGCGGTGCGTTCTGTGGTGTGGG + Intergenic
1160705738 19:529423-529445 CACAGTGCTTCCTGGGATGTGGG + Intergenic
1161208967 19:3056538-3056560 TCCAGGGCGGGCTGGGATGCTGG - Intronic
1162181385 19:8871429-8871451 TGCAGTGGGGGCTGGGGGGTGGG + Intronic
1164590848 19:29506065-29506087 CGCAGGGCGTGCTGGGGCGTGGG - Intergenic
1166895265 19:46018555-46018577 GGCAGTGCATGCTGGGAGGGAGG + Exonic
1167587418 19:50382856-50382878 TGCACTGCGTGCTGGGCTTGAGG - Exonic
1168145421 19:54417603-54417625 TGCAGTGTGTGCTTGTATATGGG - Intronic
1168445017 19:56404260-56404282 CGCAGAGGATGCTGGGATGTTGG - Intronic
925059582 2:880671-880693 TGCAGTGCATGATGGGCTGTGGG - Intergenic
926559731 2:14402829-14402851 TGGAGTGCGTGGTGTGATCTTGG - Intergenic
927655366 2:24940715-24940737 TGGAGTGCGTGGTGCGATCTCGG + Intergenic
928695885 2:33849502-33849524 TGCAGTGGTTGATGGGATTTAGG + Intergenic
930758426 2:55004037-55004059 TGGATTACATGCTGGGATGTAGG - Intronic
933083500 2:78024227-78024249 AGCAGTCCATGGTGGGATGTGGG + Intergenic
936243745 2:110809071-110809093 GGCAGTGGGGGCTGGTATGTGGG - Intronic
937235598 2:120430223-120430245 TGCTGTGTGTACTGGGTTGTGGG - Intergenic
937334993 2:121056850-121056872 TGCAGTAGGTGCTGGGGTGCAGG + Intergenic
937532621 2:122847111-122847133 TGCAGTGAGTGGTGTGATCTTGG - Intergenic
938422231 2:131154771-131154793 TCCAGTGCGTCCGGGGGTGTGGG - Intronic
938702666 2:133893261-133893283 TGCAGTGTGTGTGGGGATTTTGG - Intergenic
940912192 2:159218590-159218612 AGCAGTTCCTGCTGGGATGGTGG + Intronic
942468143 2:176230531-176230553 TAGAGTGCGTGGTGCGATGTTGG + Intergenic
944574012 2:201073715-201073737 TGCAGTGGGTGGTGCAATGTCGG - Intronic
946179498 2:217941225-217941247 GGGGGTGGGTGCTGGGATGTTGG - Intronic
947331374 2:229032990-229033012 TGCAGAGCTGGCTGGGGTGTTGG - Intronic
1168901123 20:1365825-1365847 TGCAGTGGGTGTGGGGAGGTAGG - Intronic
1168910854 20:1445556-1445578 TGGAGTGCCTGCTGGTATTTAGG + Intronic
1171484015 20:25474663-25474685 TGCAGTGAGTGGTGTGATCTCGG + Intronic
1171866102 20:30488437-30488459 TGCAGTGCGTGCAGGGAAGAGGG - Intergenic
1173997192 20:47347390-47347412 TGTAGAGCTTGCTGGGATGCCGG - Intronic
1174198545 20:48790816-48790838 TGCACTGAGGGCTGGGCTGTGGG - Intronic
1175686405 20:61031561-61031583 TGTAGTGCGTGCTGGGGGGGCGG - Intergenic
1176094134 20:63332055-63332077 TGCAGTGGGAGCTGGCATTTGGG - Intronic
1178124755 21:29504566-29504588 TGCAGTGCCTGTTGGGATACAGG - Intronic
1179906718 21:44426535-44426557 TGCCCTGCATGTTGGGATGTTGG + Intronic
1180312815 22:11253311-11253333 AGCAGTGCGTGCAGGGAAGAGGG - Intergenic
1180483765 22:15777137-15777159 TGCAGCGCGTGTTAGGAGGTTGG - Intergenic
1180702487 22:17789226-17789248 TGCAGTGGATGCTGGGATGCAGG - Exonic
1180800482 22:18629586-18629608 TGCAGTGCAGACTGGGATGCTGG + Intergenic
1180851717 22:19025143-19025165 TGCAGTGCAGACTGGGATGCTGG + Intergenic
1181221237 22:21365676-21365698 TGCAGTGCAGACTGGGATGCTGG - Intergenic
1182676517 22:32043420-32043442 TGCAGCGGGTTCTGGGATGCGGG + Intronic
1184217276 22:43076093-43076115 GGCAGTGCCTGGAGGGATGTGGG - Intronic
1184296039 22:43526239-43526261 TGCAGGGAGTGCTGGCAAGTTGG - Intergenic
950753950 3:15156398-15156420 TGCAGTGTGGGCAGGGATGGAGG + Intergenic
951743492 3:25950491-25950513 TGGAGTGAGAGCTGTGATGTAGG + Intergenic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
956613094 3:71144338-71144360 TGCCTTGCATGCTGGGTTGTAGG - Intronic
964256116 3:154776434-154776456 TGTAGTGAGTGCTGTGATGGAGG + Intergenic
967097375 3:186188095-186188117 TGGAGTCCTTGCTGGGCTGTGGG + Intronic
967332620 3:188306669-188306691 TGCAGTGCGTGGTGGGGAATGGG + Intronic
967631985 3:191755214-191755236 TGCAGTGCATGGTGAGATCTTGG - Intergenic
973953518 4:56040562-56040584 TGCAGTGAGTGGTGTGATCTTGG + Intergenic
977736593 4:100424530-100424552 TGCAGTGCGTGCTGGGATGTGGG - Intronic
985045528 4:185936840-185936862 TGCCGTGCATGCTGTGCTGTTGG - Intronic
985188475 4:187345248-187345270 TCCAGTGTGTTGTGGGATGTGGG - Intergenic
985303506 4:188514263-188514285 TTCACTGCTTGCTGGTATGTGGG + Intergenic
990365073 5:55062254-55062276 TGCGGGGTGTGGTGGGATGTGGG - Intergenic
995548654 5:113257708-113257730 GGGTGTGGGTGCTGGGATGTGGG + Intronic
997644091 5:135468733-135468755 GGCAGTGGGCTCTGGGATGTAGG - Intergenic
1000111615 5:158113431-158113453 TGCAGAGGGTGCTGGGGAGTTGG + Intergenic
1000981156 5:167818618-167818640 TGCCCTGAGTGCTGTGATGTGGG - Intronic
1001606703 5:172965521-172965543 TTCACTGAGTGCTGGGATGGAGG - Intronic
1002314112 5:178332243-178332265 TGCAGTGAGTGCTGGAAGGTGGG - Intronic
1002807284 6:589633-589655 TGCAGTGCGAGCTGGCCTCTTGG - Intronic
1003512241 6:6791213-6791235 TGCAGTGCTTGCTGGCATCATGG - Intergenic
1005016574 6:21380210-21380232 TGAAGGACGTGCTGGGATGAAGG - Intergenic
1006034531 6:31201246-31201268 TGCAGTTGGTGCTGGCTTGTTGG + Intronic
1006139744 6:31921061-31921083 GGCAGTGCCTGCTAGGATGGGGG + Intronic
1007607773 6:43129009-43129031 TGCAGTGCATCCTGGGAGGACGG - Exonic
1007758043 6:44113663-44113685 TCCAGAGCTTTCTGGGATGTGGG - Exonic
1011555091 6:88565426-88565448 TGCACTGTGTGCTGGGCTGAAGG + Intergenic
1015906957 6:138127592-138127614 TGTAGTGTGTGCTGGGAGGGTGG + Intergenic
1016468390 6:144349057-144349079 TGGAGCGCGTGATGGGATCTCGG + Intronic
1016945996 6:149534103-149534125 TGGAGTGCGTGGTGGGATCTCGG - Intronic
1018606870 6:165606810-165606832 TGCAGTGCGTGCAGGGGCTTAGG + Intronic
1023541973 7:41275383-41275405 TGCTGTGCCTGCTGGGGTCTGGG - Intergenic
1023837254 7:44075544-44075566 GGCAGTGCCTGCTGGGCTGTGGG + Intronic
1029455813 7:100671704-100671726 TGCAGTGAGTGGTGTGATTTTGG + Intergenic
1030981190 7:116186655-116186677 TGGAGTGGGTGCTGGGAGTTGGG + Intergenic
1031601597 7:123716776-123716798 TGCAGTTGCTGGTGGGATGTGGG + Intronic
1032370079 7:131340326-131340348 TGGAGTGCGTGGTGCGATCTTGG + Intronic
1032501419 7:132403101-132403123 AGCACTGCCTCCTGGGATGTTGG - Intronic
1035333421 7:158111098-158111120 TGCAGTGCGGACGGGGCTGTGGG + Intronic
1035399001 7:158552473-158552495 TGGAGTGCGGGCTGGAGTGTAGG + Intronic
1035675231 8:1451430-1451452 TTCAGAGCGTGCTGGGCTGATGG - Intergenic
1039434917 8:37553439-37553461 TGCAGTGTCTGCTGGGATGACGG - Intergenic
1040563463 8:48545308-48545330 TGCAGGGTCTGCTGGGAGGTGGG + Intergenic
1041818933 8:62006716-62006738 AGCAGTGCGTTCTGAGATTTTGG - Intergenic
1044792581 8:95863245-95863267 TTCAGTGGGCTCTGGGATGTAGG - Intergenic
1044850145 8:96419725-96419747 CGCAGTGCATGCTGGGAAGGGGG - Intergenic
1046262233 8:111783570-111783592 TGCAGAGCTTCCTGGGAAGTGGG + Intergenic
1047303780 8:123637056-123637078 TGTGGAGGGTGCTGGGATGTGGG - Intergenic
1048360753 8:133695241-133695263 TGCAGTGGCAGCTGGGATGGAGG + Intergenic
1048970993 8:139644930-139644952 TGCACTGTGGGCGGGGATGTGGG - Intronic
1049015723 8:139918654-139918676 AGCAGTGCTGGCTGGGATGGAGG - Intronic
1049094762 8:140541850-140541872 TGGAGTGCGTGGTGTGATCTCGG - Intronic
1049681496 8:143920559-143920581 GGCAGTGCGTGCTGGCCTGGTGG - Exonic
1058882770 9:109299892-109299914 TGCTGTGAGTGCGGGGATGGGGG - Intronic
1061013647 9:127969641-127969663 AGCAGGGCCTGCTGGGCTGTGGG - Intronic
1061512485 9:131069573-131069595 GGCAGTGCGTGCTGGGTTCTGGG - Intronic
1061714740 9:132511574-132511596 TGCAGTGCGTCCTGGATTTTGGG + Intronic
1061890383 9:133616214-133616236 AGCACTGGGTGCTGGGATGCAGG + Intergenic
1061937882 9:133868260-133868282 TGCGGTGCCTGCTGTGCTGTGGG - Intronic
1062036428 9:134384614-134384636 TGCAGGGCGTGCTGGGGGGCAGG + Intronic
1062073506 9:134572054-134572076 TACAGCACGTGCAGGGATGTGGG - Intergenic
1185461023 X:332825-332847 TGCATTGGGTACAGGGATGTCGG + Intergenic
1186821315 X:13291037-13291059 TGCAGTGGGTCCTGGACTGTGGG + Intergenic
1187553429 X:20328347-20328369 TGCAAAGCATGCTGGGGTGTTGG - Intergenic
1187952231 X:24482258-24482280 TGGAGTGCGTGGTGTGATCTTGG + Intronic
1188180566 X:27050482-27050504 TGCAGGGCGGGGTGGGTTGTAGG - Intergenic
1189307338 X:39996750-39996772 TGCAGTCAGTGATGTGATGTTGG - Intergenic
1190559283 X:51671219-51671241 TGCAGTGTGTGCTGGGGTCCTGG - Intergenic
1190565008 X:51722102-51722124 TGCAGTGTGTGCTGGGGTCCTGG + Intergenic
1192801556 X:74469740-74469762 TGCTGTGCATGCTGGGGGGTAGG - Intronic
1194941902 X:100020647-100020669 TCCAGTGTCTGCTGGGCTGTTGG - Intergenic
1195726113 X:107918340-107918362 TGCAGTGAGGGCTGGGGTGAGGG + Intronic
1198254793 X:134915252-134915274 TGCACTGCCTGCTGGGATACCGG + Exonic
1201781697 Y:17730033-17730055 TGCAGAGAGTCCTGGCATGTTGG + Intergenic
1201819856 Y:18175957-18175979 TGCAGAGAGTCCTGGCATGTTGG - Intergenic
1202085585 Y:21133351-21133373 TGAAGTGGGTGGTGGGATGGTGG - Intergenic