ID: 977736935

View in Genome Browser
Species Human (GRCh38)
Location 4:100428002-100428024
Sequence CAGGGTGATCACAGAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977736935 Original CRISPR CAGGGTGATCACAGAGTAGA TGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
903269142 1:22176970-22176992 CAGGGTGAGCCCAGAGGACATGG + Intergenic
904642933 1:31944383-31944405 CAGAGTGATAACTGGGTAGAAGG + Intronic
904908042 1:33912684-33912706 TGGGGTGCTCACAGAGTAGGGGG - Intronic
906904694 1:49877152-49877174 CAGGGCAATCACACAGGAGACGG - Intronic
907896953 1:58701073-58701095 CATGGTGAGCACTCAGTAGAGGG - Intergenic
908801472 1:67885034-67885056 GAGGGTGCCCACAGAGGAGATGG + Intergenic
909400481 1:75223291-75223313 CAGGCTGAGAACAGAGCAGATGG - Intronic
912312987 1:108641723-108641745 CATGGAGATAAGAGAGTAGAAGG + Intronic
912469900 1:109899448-109899470 CTGCGTTATAACAGAGTAGAAGG + Intergenic
913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG + Intronic
913448035 1:118970756-118970778 CAGGGTAATCACTGAGCAAATGG - Intronic
915988855 1:160492890-160492912 CAGGGTGATAGCAGTGGAGATGG - Intronic
917008518 1:170444249-170444271 CAGACTGAGCACAGAGCAGATGG + Intergenic
918110826 1:181454003-181454025 CAGGGTTCTCACAGTGCAGAGGG + Intronic
918460713 1:184773905-184773927 CATAGAGATAACAGAGTAGAAGG - Intergenic
920868762 1:209775574-209775596 GAGGGAGATCAGAGAGGAGAGGG - Intronic
921993493 1:221392692-221392714 CAGGTTGATCACAGTGTTTAGGG + Intergenic
923109606 1:230880073-230880095 CAGGGTGATTGCAGAGGAGGAGG - Intergenic
1063172282 10:3519673-3519695 CAGGCTGGGCACAGAGTAAAGGG + Intergenic
1063925432 10:10972906-10972928 CAGGATGATCACATGATAGATGG + Intergenic
1064451308 10:15444641-15444663 CAGGGAGATCACAGAGCTGAAGG + Intergenic
1064800102 10:19060720-19060742 GAGAGAGGTCACAGAGTAGAAGG + Intronic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1067810272 10:49420903-49420925 CAGGTTTATCAAAGATTAGATGG + Intergenic
1068398700 10:56499669-56499691 CAGTGTGAACACAGAGTTGCAGG + Intergenic
1069890671 10:71650371-71650393 AAGGGTGATCACACAGAGGAAGG + Intronic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072843776 10:98805096-98805118 CATGGAGATAAGAGAGTAGAAGG + Intronic
1073422372 10:103434644-103434666 CAGGGTGATCTCAGTCTAGATGG + Intronic
1075157409 10:119989550-119989572 CAGGGTGATCTCTGGGTAGGTGG + Intergenic
1075688580 10:124380297-124380319 CGGGAGGATCACAGAGGAGATGG - Intergenic
1076702245 10:132279904-132279926 CAGCGTGATCACGGAGTGTAGGG - Intronic
1076702304 10:132280207-132280229 CAGCGTGATCACAGAGTGCAGGG - Intronic
1076702365 10:132280510-132280532 CAGCGTGATCACGGAGTGCAGGG - Intronic
1076702422 10:132280832-132280854 CAGTGTGATCACGGAGTGCAGGG - Intronic
1076865260 10:133163457-133163479 CAGGATGAGCTCAGAGCAGAAGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078522388 11:12073783-12073805 CAGAAGGATCACAGAGGAGACGG + Intergenic
1078705180 11:13736942-13736964 CTGGGTTATCACAGAGTAAATGG + Intergenic
1078706420 11:13748153-13748175 AAGGGAGATAACATAGTAGAAGG - Intergenic
1080852558 11:36082598-36082620 CAGGGTGGTCACAGTCAAGAAGG - Intronic
1084967296 11:72751448-72751470 CAAGATCATCACAGGGTAGAAGG - Intronic
1086921065 11:92587693-92587715 CAGGGTGGTTTCAGAGTATATGG + Intronic
1086960744 11:92978134-92978156 GAGGGTGAGCACAGAGGAGGGGG + Intronic
1087043148 11:93821049-93821071 CACGGTGATGACATAGTAGCCGG + Exonic
1087179556 11:95128426-95128448 CAGGCTGTTCACAGAGGTGATGG - Exonic
1088020783 11:105116019-105116041 CAGAGTGATCAGACAGCAGAAGG + Intergenic
1088131553 11:106497878-106497900 TGGTGTGATCACAGACTAGATGG - Intergenic
1088883021 11:113986537-113986559 CAGGCTGACCACATAGAAGAGGG - Exonic
1089659528 11:119977004-119977026 CGTGGTGCTCACAGAGGAGAGGG + Intergenic
1090240690 11:125179491-125179513 CAGGGGGAGCATAGAGTTGAAGG + Intronic
1090550780 11:127817499-127817521 CTGTGTCATCACATAGTAGAAGG - Intergenic
1090961885 11:131564407-131564429 CTGTGTGCTCACATAGTAGAGGG + Intronic
1091193138 11:133710959-133710981 CAGGGAGGTCACAGAGGGGAGGG - Intergenic
1091897661 12:4118042-4118064 CAGGGTGTTCACAGGGTACCAGG - Intergenic
1092856023 12:12674432-12674454 CAGGGTGATGGCAGTGTAGGTGG + Intronic
1093428230 12:19053599-19053621 CAGGGTGATCTGTGAGTACAAGG - Intergenic
1095527663 12:43147103-43147125 CAGGGTGGTCTCAGGGTAGGTGG + Intergenic
1096767940 12:53909579-53909601 CATGGAGCTTACAGAGTAGAGGG + Intergenic
1097412529 12:59272768-59272790 CAGGTTTGTCACAGATTAGATGG - Intergenic
1097547806 12:61026314-61026336 CAGTATGATCACAGAATAAAAGG - Intergenic
1097808176 12:63988421-63988443 AAGGGAGATCTCAGGGTAGAGGG + Intronic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1101069401 12:101058145-101058167 CAGGTTTATCAAAGATTAGATGG + Intronic
1101156404 12:101931789-101931811 CAGGGTCAGCCCAGAGTAGCAGG + Intronic
1101858307 12:108462692-108462714 CATCGTGATCACAGAGGAGAAGG - Intergenic
1104225853 12:126832245-126832267 GATGGTAATGACAGAGTAGAAGG - Intergenic
1104935059 12:132360093-132360115 CAGGGTGTCCCCAGAGGAGAAGG + Intergenic
1105944729 13:25179577-25179599 CTGTGTCATCACATAGTAGAAGG + Intergenic
1106754770 13:32811541-32811563 CAGGGAGCTCACAGAGGAGCAGG - Intergenic
1108068899 13:46607161-46607183 CAGCTAGATCACAGAGGAGATGG + Intronic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1110392826 13:74994930-74994952 GATGGTGTTAACAGAGTAGAAGG - Intergenic
1111629579 13:90832783-90832805 GGGGGTGATCACAGGGTGGAAGG + Intergenic
1112405701 13:99118353-99118375 CAGGGTGATCTCAGGGTAGTTGG + Intergenic
1114375675 14:22144068-22144090 CAGGGTGGACTCAGAGTGGAAGG + Intergenic
1116858755 14:49977089-49977111 CATGGTGATCTCAGGGTAGTTGG + Intergenic
1117575440 14:57092635-57092657 CAGTGTGATCACTGTGGAGATGG + Intergenic
1117789092 14:59319660-59319682 CCAGGTGATCACAGAGTGAAAGG + Intronic
1118263015 14:64265795-64265817 AAGGGTGATAACAGACTACATGG + Intronic
1118449845 14:65890314-65890336 TTGGGTGATCACTGAGAAGAGGG + Intergenic
1118467345 14:66042897-66042919 CAGGGTGATAGCAGTGGAGATGG + Intergenic
1118820330 14:69341421-69341443 CAGGGTGAGCACAGACCATACGG - Intronic
1120560037 14:85980177-85980199 CAGGGTGATGTCAGAGTGTAGGG - Intergenic
1121154462 14:91669937-91669959 CAGGGTGCTCACAGAGGCAATGG + Exonic
1122265417 14:100544534-100544556 CAGTGTGTTCACAGAGAAAATGG + Intronic
1124899291 15:33807632-33807654 CATGGTGATCACAGTGCAGAGGG - Intronic
1127368145 15:58310414-58310436 CAGGGTGACACCAGAGTAAAAGG + Intronic
1128659545 15:69488184-69488206 CAGGGAGCTCAGAGAGTAGCAGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1130512108 15:84598550-84598572 CAGGGAACTGACAGAGTAGAAGG - Intergenic
1131470327 15:92691054-92691076 CATGGTGTTCAAAGAGAAGATGG - Intronic
1132396573 15:101479369-101479391 CTGGGTGAGCACAGAGCAGTGGG + Intronic
1133313951 16:4870563-4870585 CAGGGCGATGCCAGAGCAGATGG + Exonic
1134112773 16:11525539-11525561 CCGAGTGATCAAAGAGTTGAAGG - Intergenic
1135539147 16:23316635-23316657 GATGGTGATGACAGAGGAGATGG - Intronic
1135659714 16:24285398-24285420 CAGGGTGAGAATAGAGTAGGGGG - Intronic
1135893302 16:26376223-26376245 CAGGGTGATCACAGCGTACTGGG - Intergenic
1135922931 16:26667517-26667539 CAGGGTTCCCACAGAGCAGAAGG + Intergenic
1136984186 16:35084159-35084181 GAGGGTGGTCACTGAGCAGATGG - Intergenic
1137323249 16:47407882-47407904 CAGGGTTATGACCCAGTAGATGG + Intronic
1138564176 16:57820579-57820601 CAGAGTGATCTTAGAGTTGATGG + Intronic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139281003 16:65770422-65770444 CAGGGTGATCAGACACCAGATGG - Intergenic
1140732189 16:77866440-77866462 AGCTGTGATCACAGAGTAGATGG - Intronic
1141244528 16:82293564-82293586 CAGGGGGATCATAGGGTTGAAGG + Intergenic
1141309110 16:82895903-82895925 CAGTGTGTTCAAAGAGCAGAGGG - Intronic
1141334609 16:83142799-83142821 CAAGGTGATAAAAGAGTAAAGGG + Intronic
1144582168 17:16465197-16465219 AGGGGTGCTCACAGAGGAGAGGG - Intronic
1145086732 17:19948684-19948706 CAGGGACATCACAGAAAAGAAGG + Intronic
1146403420 17:32518114-32518136 GAGGGTGATGACAGAGTGGCAGG - Intronic
1147960845 17:44166785-44166807 CAGGAAGATCCCAGTGTAGATGG - Intergenic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1148521048 17:48275273-48275295 CAGGGAGATCAGAGAGAATAAGG - Intronic
1150335226 17:64326137-64326159 CTGGGAGATACCAGAGTAGAGGG + Intronic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1153446149 18:5174897-5174919 CAGGGTGGTCACTGATTTGAGGG + Intronic
1156481905 18:37441630-37441652 GAGGGTGACCACAAAGCAGATGG - Intronic
1158198948 18:54918846-54918868 CAGGCTGCTCCCAGAGAAGAAGG + Intronic
1158250224 18:55479618-55479640 CAGGCTGATCAAAGAGGAAAAGG - Intronic
1158792476 18:60798455-60798477 CAGGTTTATCAAAGAGCAGATGG + Intergenic
1159116988 18:64125910-64125932 CTGTGTGATCTCACAGTAGAGGG - Intergenic
1159155702 18:64578803-64578825 CAAGGTCATCAAAGATTAGATGG + Intergenic
1159248713 18:65845439-65845461 CAGGGCAATTACAGAGAAGAGGG - Intronic
1159804183 18:72935752-72935774 CAGAATGATCACAGAATAGCTGG - Intergenic
1160139987 18:76312833-76312855 CAGGCTGTTCACAGAAGAGATGG + Intergenic
1160144526 18:76352577-76352599 CAGGGTCAACACAGAGGACAAGG + Intergenic
1160579390 18:79875032-79875054 CTGGGAGATCACAGGGCAGAAGG - Intronic
1161589393 19:5122293-5122315 CAGGGTCCTCACCGGGTAGAAGG - Intronic
1161948433 19:7453573-7453595 CAGGGAGATCGCAGGGAAGATGG + Exonic
1163407325 19:17131018-17131040 CAGGGTGATCAGATAGTACCTGG - Intronic
1164100453 19:22050372-22050394 CAGGGACATGACAGAGAAGAAGG + Intergenic
1165611127 19:37154107-37154129 CAGGCTGAACACAGAGAAAAGGG + Intronic
1167381031 19:49138202-49138224 CAGGCTGATCCAAGAGGAGAAGG + Exonic
1167654721 19:50756103-50756125 CAGGGTGATGTCAGAGGAGGGGG - Intergenic
1167656400 19:50767182-50767204 CAGGGTGATGTCAGAGGAGGGGG - Intergenic
925824321 2:7832569-7832591 CAGGGAGATCACTAAGAAGAGGG - Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
929546232 2:42856713-42856735 CAGGGTGGTTACAGGGTGGAGGG - Intergenic
929759968 2:44798567-44798589 CAGAGTGATCCCTGAGGAGATGG - Intergenic
930289502 2:49475971-49475993 CGGGGTGATCCCACGGTAGAAGG - Intergenic
930864277 2:56107560-56107582 GAGTGTGGTCACAGAGTCGATGG - Intergenic
931243627 2:60475107-60475129 CAAGGTGGGCACAGAGTAAATGG + Intronic
933161161 2:79026515-79026537 AAGGGTAATAACAGACTAGATGG + Intronic
934671746 2:96218200-96218222 CAGGGTCATCAGAAAGTAAAGGG - Intergenic
934776290 2:96939701-96939723 CTGGCTGACCACAGAGGAGATGG + Intronic
935126311 2:100226579-100226601 CAGGGGGATCCCAGTGTTGAGGG - Intergenic
936159103 2:110070684-110070706 CAGGGTGATCGTAGACCAGAAGG + Intergenic
936185558 2:110300648-110300670 CAGGGTGATCGTAGACCAGAAGG - Intergenic
936861339 2:117024251-117024273 CATCTTGATCACAGAATAGATGG - Intergenic
938019569 2:127895088-127895110 CACAGAGATCACAGAATAGAGGG + Intergenic
938804404 2:134792726-134792748 CATGATGAACACAGAGTTGATGG + Intergenic
940223982 2:151382823-151382845 CAGGGTGCTCACAAAGCAGGAGG + Intergenic
941440787 2:165532707-165532729 CAGGGTGATCAGGCAGGAGAAGG + Intronic
941612494 2:167678496-167678518 TAGGGAGGTCACAGTGTAGAAGG - Intergenic
942059540 2:172215513-172215535 CTGGGTGATGAGAGAGTAGGAGG + Intergenic
942959566 2:181813797-181813819 CATGGTGATTCCTGAGTAGATGG + Intergenic
943355297 2:186848527-186848549 CAGAGTGAGCAAAGAGTAAAGGG + Intronic
944637241 2:201686357-201686379 CAGGGGCATCACAGATTACATGG - Intronic
947870386 2:233433636-233433658 CAGAATAATCACAGAGTAAATGG - Intronic
948930432 2:241128419-241128441 CAGGATGATCACAGAGCCAAGGG + Intronic
1169492662 20:6084202-6084224 CAGGGTGATCACAGAGCAGCCGG - Intronic
1173868426 20:46327625-46327647 CAGGGTGTTTCCAGGGTAGAAGG - Intergenic
1174205582 20:48835917-48835939 CAGGGTGATACCAGAGGAGATGG + Intergenic
1178702533 21:34845577-34845599 CAGAGTGTTCACACAGAAGAGGG - Intronic
1180159858 21:45994182-45994204 CAGGGTGATCAGGGAAGAGAAGG + Exonic
1180191843 21:46169239-46169261 GAGGATGCTCACAGAGCAGAAGG - Intronic
1181330358 22:22086310-22086332 CACTGTGATCACTGAGCAGAGGG - Intergenic
1183310965 22:37109338-37109360 GAGGGTGATCAGTGAGCAGAAGG - Intronic
1183467099 22:37985296-37985318 CAGGGTGAGCCCAGTGTGGAAGG - Intronic
949475217 3:4438430-4438452 AAGGGTGATCACACATTTGAGGG - Intronic
952550149 3:34467594-34467616 CAGGTTTATCAAAGAGCAGATGG + Intergenic
952572743 3:34736708-34736730 CAGGTTGGTCAAAGATTAGATGG - Intergenic
953064119 3:39453748-39453770 CAGGGAGAAAACAGAGAAGATGG + Intergenic
953069042 3:39501984-39502006 CAGGGGGCTTCCAGAGTAGAGGG + Intronic
953364206 3:42328246-42328268 CAGTGTCTTCACATAGTAGAAGG - Intergenic
953862701 3:46558625-46558647 CAGGGAGATCACAGAGAGGGAGG - Intronic
957509848 3:81173482-81173504 CAGGGTGACCACAAAGTATCTGG + Intergenic
957537325 3:81523676-81523698 CATGGAGATAAGAGAGTAGAAGG - Intronic
957936547 3:86951356-86951378 TCAGGTGATCACACAGTAGAAGG - Intronic
958133062 3:89454422-89454444 CCAGATGATCACAGTGTAGAGGG - Intronic
961691037 3:128669692-128669714 CTGTATGATCACAGGGTAGATGG + Intronic
962925795 3:139992345-139992367 CAGGGTTATCAAAGAGAAGGAGG - Intronic
965606043 3:170498601-170498623 TAGGTTGGTCACAGGGTAGAAGG + Intronic
965868631 3:173238261-173238283 CAGGGAGATTAGAGAGTGGAGGG - Intergenic
966908808 3:184546468-184546490 CAGGAAGTTCACAGACTAGAGGG + Intronic
967737379 3:192967124-192967146 CAGGTTTATCAGAGATTAGATGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968804116 4:2761722-2761744 CAAGGTGGTCACAGAACAGACGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969903158 4:10368582-10368604 CAGGCTGATCCAGGAGTAGATGG + Intergenic
970044264 4:11832307-11832329 CAGGGTGATCTGAGAGTAACTGG + Intergenic
970714303 4:18904109-18904131 CAGAGTGATGGTAGAGTAGAAGG + Intergenic
971136616 4:23875642-23875664 CTGGGTGATAAAAGAGAAGAAGG - Intronic
972222037 4:36966809-36966831 CAGGGAGATCACACAGGAGGAGG - Intergenic
972337421 4:38119847-38119869 CAGGCTGACCACAGACTGGAGGG + Intronic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
974030442 4:56771768-56771790 CAGGGTTATGACAGAGCACACGG - Intergenic
975150536 4:71015930-71015952 CAGGGTAATCAGGTAGTAGAAGG + Intronic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
979161735 4:117470158-117470180 CAGGTTGTTCACAAAGTGGAAGG + Intergenic
981004213 4:139858719-139858741 CCGGGTGATCACAGAGCGGTCGG - Intronic
981105567 4:140876673-140876695 GAGGGTGAGCACATAGAAGATGG + Intronic
981855550 4:149286417-149286439 TAGGGCGATCACAGAGAGGAAGG + Intergenic
982575627 4:157106445-157106467 AAGGGTGTTTTCAGAGTAGATGG + Intronic
986033118 5:3911610-3911632 AAGGGTGATCAAACATTAGAGGG - Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986321760 5:6637253-6637275 CACTGTAATCACAGAGCAGAGGG - Intronic
986336692 5:6760657-6760679 CAGGCTGTTCACAGAGCAAAAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987005211 5:13703563-13703585 CAGGGTCATTAGAGAGCAGAGGG - Intronic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
990406896 5:55500713-55500735 CAGTGTGAAGACAGAATAGACGG + Intronic
990625696 5:57607999-57608021 CTGTGTCATCACACAGTAGAAGG - Intergenic
990918887 5:60940527-60940549 CCAGGAGATCACAGAGAAGAAGG + Intronic
990924028 5:60998652-60998674 CAGGATGATCACAGAGATTAGGG - Intronic
994392745 5:99205698-99205720 CAGGGTGTTTACAATGTAGAGGG + Intergenic
994619106 5:102141796-102141818 TATGGAAATCACAGAGTAGAAGG - Intergenic
998730923 5:145076190-145076212 CAGGGAGATTACACATTAGAGGG - Intergenic
998958262 5:147458852-147458874 CAGGGAGAACACAGTGTATAGGG + Intronic
999429727 5:151515708-151515730 CAGGGTGATGACAGAGGAATTGG - Intronic
999655036 5:153802865-153802887 CAAGGTCAGCACAGAGTAGAGGG - Intronic
1002172625 5:177383971-177383993 CAGGGGGAGCTCAGAGGAGAGGG - Intronic
1002843104 6:922845-922867 CAGGGTGAACCCAGAGAAGCAGG - Intergenic
1003153224 6:3570427-3570449 CAGGGAGATCACAGATTGCAAGG - Intergenic
1004450225 6:15738637-15738659 CAGGGTGATCACACATTACCTGG - Intergenic
1006222856 6:32508984-32509006 CAGGTTTATCACAGATCAGATGG - Intergenic
1008447683 6:51611693-51611715 CTGGGAGATCACGGAGTAAATGG - Intergenic
1011532815 6:88342582-88342604 CAGGGAGAGCACTGAGTAGTTGG + Intergenic
1012233804 6:96789786-96789808 CAGGCTCTTCACAGGGTAGAGGG - Intergenic
1013448611 6:110256631-110256653 CAAGGTGATCACAGAGGTGGAGG - Intronic
1013542797 6:111127786-111127808 AAGGGTGGAAACAGAGTAGAGGG + Intronic
1013627774 6:111954653-111954675 CAGGGAGCTCACAGAGAGGATGG - Intergenic
1014808549 6:125859108-125859130 CAGATTCATCACAGAGTTGATGG - Intronic
1017248429 6:152253182-152253204 TAGGGTGATCTCAGGGAAGATGG - Intronic
1017350893 6:153440733-153440755 CAGAGTGCTCACTAAGTAGAAGG - Intergenic
1018827206 6:167417451-167417473 CAGAGTGATCATTTAGTAGATGG - Intergenic
1019686262 7:2383863-2383885 CGGGCTGATAACAGAGCAGAGGG - Intergenic
1020908178 7:14092529-14092551 CAGTCTGCTCACAGAGTAGATGG - Intergenic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1024324940 7:48102101-48102123 CAGGGTGAGCCCACAGTAGCTGG + Intronic
1024330969 7:48155113-48155135 GAGGAACATCACAGAGTAGAAGG - Intergenic
1026766073 7:73160680-73160702 CAGGGTTACCACAGAGGACAAGG - Intergenic
1027042548 7:74970376-74970398 CAGGGTTACCACAGAGGACAAGG - Intronic
1027081095 7:75231981-75232003 CAGGGTTACCACAGAGGACAAGG + Intergenic
1030108699 7:106008461-106008483 GAAGGTGCTCACAGAGTATATGG - Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031829223 7:126605928-126605950 CAGGGAACTCACAGATTAGAAGG - Intronic
1034615018 7:152408704-152408726 CAGGGGGAGCACGGAGTGGATGG - Intronic
1034705659 7:153140773-153140795 CAGGTTTATCAAAGAGCAGATGG + Intergenic
1034718953 7:153270277-153270299 CAGGGTGATCAGGCAGGAGAAGG + Intergenic
1035204178 7:157284060-157284082 CAGGGTGAGGACAGCGTAGGAGG + Intergenic
1035255635 7:157624701-157624723 CAGGATGACCACAGTATAGACGG - Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036587396 8:10136880-10136902 CAGGGTGGACACTGAGTACAGGG - Intronic
1036649487 8:10633274-10633296 GTGGGAGATCAGAGAGTAGAGGG - Intronic
1037760783 8:21740130-21740152 CAGTGTGATGACAGAGCAGCTGG + Intronic
1038158406 8:25013115-25013137 CAGGGCAATCAGAGAGGAGAAGG + Intergenic
1039704432 8:39992286-39992308 CAGAGTGATCTCAGGGTAGGTGG - Intronic
1040531918 8:48272946-48272968 CAGGTTTATCAAAGAGCAGATGG - Intergenic
1041159013 8:55018359-55018381 CAGAGTGATATCAGAGAAGAAGG + Intergenic
1041718104 8:60950446-60950468 CAGGGTGGCCACACAGTACAGGG + Intergenic
1042692259 8:71513772-71513794 CAAGGACATCATAGAGTAGAAGG - Intronic
1043456185 8:80414642-80414664 CAGGGTGGTAACAGAGTAACTGG + Intergenic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1045909532 8:107390614-107390636 CAGGATGATCAGAAAATAGAAGG + Intronic
1048881548 8:138876424-138876446 CAGGGTGCTCATAGTCTAGAAGG - Intronic
1051090720 9:13404572-13404594 CAGGGCAATCACACAGGAGAAGG - Intergenic
1052330453 9:27262055-27262077 CAGTGTGATTACAGAGTAACAGG + Intergenic
1053196783 9:36125954-36125976 CAGGGTGCTCACAGGACAGAGGG - Intergenic
1053331136 9:37208700-37208722 CAAAGTGATGGCAGAGTAGATGG - Intronic
1053612730 9:39731756-39731778 CTGGGTCATCATAGAGGAGATGG + Intergenic
1053870772 9:42489718-42489740 CTGGGTCATCATAGAGGAGATGG + Intergenic
1054085523 9:60739399-60739421 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054240786 9:62610634-62610656 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054554920 9:66645158-66645180 CTGGGTCATCATAGAGGAGATGG - Intergenic
1055476614 9:76669230-76669252 CAGTGTGATCACTGTGTGGAGGG - Intronic
1057065365 9:92044652-92044674 CAGGCTGATGACAAAGTAGCAGG + Intronic
1057788426 9:98105753-98105775 CAGGGGGAGCACAGAGTACCTGG + Intronic
1058635903 9:107038474-107038496 CAGGGGAATTACATAGTAGATGG - Intergenic
1059304491 9:113343150-113343172 TAGGGCTAGCACAGAGTAGATGG + Intergenic
1062728672 9:138096211-138096233 CAATGTGATCACAGAGAGGAAGG + Intronic
1187967591 X:24627760-24627782 CAGGGTGATCGCAGCGGAGGTGG + Intronic
1189741425 X:44120872-44120894 CAGGGTGGTTACAGAGGAGTAGG - Intergenic
1192991389 X:76461607-76461629 CATGGAGATCAGGGAGTAGAAGG - Intergenic
1197993447 X:132344382-132344404 CAGGGTCACCACAGAATAAAAGG + Intergenic
1198709137 X:139482382-139482404 CATGGAGATAAGAGAGTAGAAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199511672 X:148629876-148629898 CTGGGGGTTCACAGAGAAGAAGG - Intronic
1199587845 X:149435234-149435256 CAGGAAGATCAAAGAGTAGGAGG - Intergenic
1199661391 X:150053959-150053981 CAGGGAGCTCTGAGAGTAGAGGG - Intergenic
1199936368 X:152577702-152577724 CTCTGTGGTCACAGAGTAGAGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200364720 X:155649766-155649788 CAGGGTAATCACACAAGAGAAGG + Intronic
1200461780 Y:3465048-3465070 CAGGTTTATCAAAGATTAGATGG + Intergenic
1200940812 Y:8779058-8779080 CAGGCTGCTAACAGAGTACAAGG + Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic