ID: 977742854

View in Genome Browser
Species Human (GRCh38)
Location 4:100507507-100507529
Sequence TTGAGTGGATGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1184
Summary {0: 1, 1: 0, 2: 4, 3: 92, 4: 1087}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977742849_977742854 16 Left 977742849 4:100507468-100507490 CCTTGTGGGTATGGGACAGTGAA 0: 1
1: 0
2: 2
3: 14
4: 148
Right 977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG 0: 1
1: 0
2: 4
3: 92
4: 1087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977742854 Original CRISPR TTGAGTGGATGGAGGGAAGA AGG Intronic
900078184 1:834944-834966 ATGGGTGGATGGAGGGAGGGAGG - Intergenic
900433313 1:2612936-2612958 CTGAATGGAAGGAGGGAACAGGG + Intronic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900509532 1:3051928-3051950 ATGAGTGGATGGATGGATGGAGG - Intergenic
900869361 1:5290910-5290932 ATGAGTGGATGGATGAATGAAGG + Intergenic
901134482 1:6984118-6984140 ATGAGTGGATAGAAGGTAGATGG + Intronic
901134487 1:6984149-6984171 ATGAGTGGATAGAAGGTAGATGG + Intronic
901258988 1:7857264-7857286 GGGAGAGGAAGGAGGGAAGAGGG - Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901587819 1:10312920-10312942 CTGAGTGGATGGATGGATAATGG + Intronic
901774664 1:11552070-11552092 TGTAGTGAATGAAGGGAAGATGG + Intergenic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901922188 1:12545268-12545290 TTGAATGAATGAAGGGAGGAAGG - Intergenic
901928637 1:12583135-12583157 GTGAGTGGATGGATGGAGTAGGG - Intronic
902397931 1:16142659-16142681 ATGAGTGGATGGATGGATGAGGG + Intronic
902397969 1:16142795-16142817 ATGAGTGGATGGATGGATGCGGG + Intronic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902562212 1:17284641-17284663 TTGGGAGGGTGGAGGGCAGAGGG - Intergenic
902710996 1:18239694-18239716 TTGACCAGATGGAGGGGAGAAGG - Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
902908894 1:19580446-19580468 CAGAGAGGATTGAGGGAAGATGG + Intergenic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
903226460 1:21896637-21896659 GTGAGTGGATGGGGGGATGCGGG + Intronic
903273644 1:22207655-22207677 AGGAGTGGAGGGAGGGAAGACGG - Intergenic
903277392 1:22230905-22230927 ATGAGTGGGTGGATGGATGATGG - Intergenic
903277442 1:22231099-22231121 ATGAGTGGGTGGATGGATGATGG - Intergenic
903294860 1:22337273-22337295 TTGAGTGGATGGATGCATAATGG - Intergenic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903689245 1:25159620-25159642 TTCACTGAAAGGAGGGAAGATGG + Intergenic
903945298 1:26959256-26959278 TTCAATGGCTGGAGGGAAGTGGG - Intronic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904345717 1:29867554-29867576 TTGAGTGAATGGAAGAATGAAGG + Intergenic
904745209 1:32706482-32706504 TTGAATGAATGAAGGGAAGGAGG + Intergenic
904993704 1:34614530-34614552 CTGAGTGGATGGATGGATGGTGG + Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906259739 1:44377949-44377971 TTGAGGGGTTGGAGGGGTGATGG + Intergenic
906277103 1:44524446-44524468 TTGGGTGGAAGGAGGGAGGTGGG - Intronic
906299264 1:44670333-44670355 GTGAGTGGCTGGAGGGAACAGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906699504 1:47847681-47847703 TTGAGTGGATTAAGGCAGGATGG - Intronic
907074303 1:51564786-51564808 TTGAGTGGAACAAGGGAAGATGG - Intergenic
907335543 1:53697138-53697160 TTGTCTGGATAGTGGGAAGACGG + Intronic
907563726 1:55414886-55414908 TGGAGTGGATGCAGTGAACAGGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
908044945 1:60158608-60158630 TTGAGTTGACGAAGGGAAGTGGG - Intergenic
908242956 1:62203365-62203387 GTGGGTGGATGTAGGGAATAGGG - Intronic
908728953 1:67206537-67206559 TCGAACAGATGGAGGGAAGAGGG + Intronic
908997993 1:70181765-70181787 TTGAGTGAATGAAGAGTAGAGGG - Intronic
909030320 1:70531506-70531528 TTGAGTGGGAGGTGGGAGGAAGG + Intergenic
909305482 1:74070475-74070497 GAGAGTGGAGGGAGGCAAGAGGG + Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
910240319 1:85079517-85079539 TTGAGAAGTTGGAGGGAGGATGG + Intronic
910700007 1:90063296-90063318 TTGAGTGGCAGGAGCCAAGATGG - Intergenic
911107138 1:94142634-94142656 TGGAGAGGAAGGAGTGAAGAGGG + Intergenic
911219268 1:95230027-95230049 TATAGTGGAAGGAGGGAAGAAGG - Intronic
911220119 1:95236461-95236483 GTGAGTGGATGAATGCAAGAAGG - Intronic
911881960 1:103251233-103251255 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
911887264 1:103319614-103319636 TTGAGTTCTTGGTGGGAAGAAGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912087510 1:106027929-106027951 TTGATAGGATGGAGGGTAGTTGG + Intergenic
912504286 1:110145230-110145252 TTGAGTGGATGGGGGATAGCTGG + Intergenic
912559757 1:110542051-110542073 TTGAGAGAATGGATGGCAGAAGG - Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912654365 1:111472376-111472398 TTGGATGGATGGAGGGAGAAAGG - Intergenic
913384211 1:118241881-118241903 TGGAGTGGAAGGTGGGCAGAGGG - Intergenic
913428145 1:118757855-118757877 TTGGGTGGATGGATGAAGGAAGG + Intergenic
913666829 1:121056592-121056614 TTGAGGGGATCGGGGCAAGATGG + Intergenic
913971353 1:143420506-143420528 TTGAATGGATGGAGGGACAGTGG + Intergenic
914018574 1:143844028-143844050 TTGAGGGGATCGGGGCAAGATGG + Intergenic
914065730 1:144246119-144246141 TTGAATGGATGGAGGGACAGTGG + Intergenic
914113421 1:144720235-144720257 TTGAATGGATGGAGGGACAGTGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915479143 1:156173297-156173319 GTGAGTGGGTGGAGGGGAGCTGG + Intronic
915647237 1:157281642-157281664 TAGAGTAGATTGAGGAAAGAGGG + Intergenic
915663418 1:157422921-157422943 TAGAGTAGATTGAGGAAAGAGGG - Intergenic
920199445 1:204250509-204250531 TGGAGTGGAGGGAGGGAGCAGGG + Intronic
920395851 1:205645479-205645501 TTGCTTGAATGGAGGGAAGCAGG + Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921245800 1:213238456-213238478 TTCAGTAGATGGAGGGAACTTGG + Intronic
921363576 1:214353074-214353096 TTGGGGGGATGGAGGGTACAGGG - Exonic
921501386 1:215907861-215907883 ATGAGTTGATGGGGGAAAGATGG + Intronic
923258051 1:232238941-232238963 TTGAGAGGCAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923520879 1:234734282-234734304 TAGAGTGGATGGAGAGAGGTGGG + Intergenic
924519500 1:244794088-244794110 TTGGGAAGAAGGAGGGAAGAGGG - Intergenic
924802284 1:247336256-247336278 TGGAGTGGGGGGAGGGAAGGGGG - Intergenic
1062933935 10:1371818-1371840 TTGTGTGGATGCAGAGAAAAGGG + Intronic
1063503820 10:6579280-6579302 TGGAGAAGGTGGAGGGAAGAGGG - Intronic
1063581510 10:7312077-7312099 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063762336 10:9094090-9094112 GCGGGTGGAGGGAGGGAAGAGGG + Intergenic
1064219959 10:13431897-13431919 TTTGGTGGATGGATGGATGATGG + Intergenic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065338587 10:24680707-24680729 GTGAGTAGAAGGAGTGAAGAGGG - Intronic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067808236 10:49407907-49407929 GTGGGTGGATGGAAGGAGGAAGG + Intergenic
1067817832 10:49496082-49496104 TCGATTGGAGGAAGGGAAGACGG - Intronic
1067878462 10:50024431-50024453 TTGGGTAGATGGAGGGGGGAAGG - Intergenic
1067893260 10:50153497-50153519 TTGGGTAGATGGAGGGGGGAAGG + Intergenic
1068077481 10:52274814-52274836 TGGTGTGGATGGAGTGAACAGGG - Intronic
1068555642 10:58455799-58455821 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1068810273 10:61247874-61247896 ATGGATGGATGGAGGGAAGTTGG - Intergenic
1068891598 10:62154154-62154176 TTGACTGGATGGACAGATGAAGG - Intergenic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1069595968 10:69670436-69670458 TTGAGTGAATGGTGGCATGAAGG + Intergenic
1070312263 10:75282348-75282370 TTCAGTCCAGGGAGGGAAGAGGG - Intergenic
1070712299 10:78691568-78691590 TAGAGTGGGTAGATGGAAGATGG + Intergenic
1071195617 10:83155670-83155692 TTGAAAGGAGGGAGGGAACAAGG - Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1071979992 10:90995752-90995774 TGGCGTGGATGTAGGGAAAAGGG + Intergenic
1072378950 10:94847218-94847240 TGGGGTGGAGGGAGGGAGGAGGG - Intronic
1072859939 10:98993064-98993086 ATGACTGGATGGAGGGACCATGG - Intronic
1072948640 10:99833524-99833546 TGGAGTGGAGGAAGGAAAGATGG + Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073661530 10:105481159-105481181 TTCAGTGGGTGGAGCCAAGATGG - Intergenic
1074360464 10:112821174-112821196 TTGTTTGGATGAAGGGAAGGAGG - Intergenic
1074550319 10:114436684-114436706 TTGAGAAGATGCAGGGAAAATGG + Intronic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075489328 10:122853089-122853111 TTGAATAGGTGGAGAGAAGAAGG - Intronic
1075516055 10:123109202-123109224 TAGAGGAGATGGAGGCAAGAAGG + Intergenic
1076046903 10:127301455-127301477 TTTGGTGGAGGGAGGAAAGAAGG + Intronic
1076602810 10:131669997-131670019 ATGAGTGGATGGATGCATGATGG + Intergenic
1076931874 10:133536885-133536907 ATGGGTGGATGGATGGAGGATGG + Intronic
1077279606 11:1736633-1736655 TGGAATGGATGGAGTGAAGTGGG + Intronic
1077279611 11:1736656-1736678 TGGAATGGATGGAGTGAAGTGGG + Intronic
1077280496 11:1742853-1742875 TTGGGTGGATGGACGGAGGGAGG + Intronic
1077280619 11:1743501-1743523 GAGAATGGATGGATGGAAGATGG + Intronic
1077283168 11:1754521-1754543 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077283178 11:1754546-1754568 TGGAGGGGATGGAGGGATGGAGG + Intronic
1077310195 11:1885127-1885149 TTGATTGGATGGAGGGACATTGG - Intronic
1077310400 11:1886411-1886433 TTGAATGGATAGAGGGACAATGG - Intronic
1077312117 11:1893525-1893547 ATGAGTGGATGGATGGATGAAGG + Intergenic
1077472211 11:2769391-2769413 TTGGGAGGATGGAGGGAGGCTGG + Intronic
1078153704 11:8780104-8780126 ATGAATGGAAGGAGGAAAGATGG - Intronic
1078465335 11:11546055-11546077 CTGAGTGGCTGGGGAGAAGAGGG - Intronic
1078541715 11:12218351-12218373 ATGAGTGGGGGGATGGAAGAAGG - Intronic
1078670134 11:13357253-13357275 TGGAGAGCATGGAGGGCAGAAGG - Intronic
1079178567 11:18167937-18167959 TTCAGGGGAAGGATGGAAGAGGG + Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1080198756 11:29643774-29643796 TGGTGTGGATGTAGGGAAAAGGG + Intergenic
1080351927 11:31395022-31395044 GAGAGTGGAGGGTGGGAAGAGGG - Intronic
1080826923 11:35856311-35856333 TAGGATGGATGGAGGGAGGATGG + Intergenic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081629960 11:44682340-44682362 ATGGGTGGATGGATGGATGATGG - Intergenic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081655669 11:44855812-44855834 ATGAGAGGATGGAAGGAGGATGG - Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081678979 11:44988631-44988653 TTGGATGGATGGATGGACGATGG + Intergenic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1082989768 11:59197323-59197345 TTTAGTGGGAGGAGGTAAGAGGG + Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083311609 11:61786614-61786636 ATGAGTCAATGGAGGGCAGACGG + Exonic
1083521737 11:63320123-63320145 TTGGGGGGATGGAGCCAAGATGG + Intronic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083911390 11:65712249-65712271 GGCAGTGGAGGGAGGGAAGATGG + Exonic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084413445 11:69016884-69016906 GTGGGTGGATGGATGGATGATGG - Intergenic
1084461884 11:69300800-69300822 ATGAGTGGGTGGATGGATGAAGG + Intronic
1084495624 11:69501500-69501522 ATGGGTGGATGGAGGAAAGGAGG + Intergenic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084546005 11:69815362-69815384 GTGAGTGGATGGGAGGAAGGAGG + Intronic
1084609812 11:70194913-70194935 ATGTGTGGATGGATGGTAGATGG + Intergenic
1084739926 11:71133133-71133155 ATGAGTGGATGGAGGGAGGGAGG + Intronic
1085374679 11:76048890-76048912 TTAAGTGGATGTAAGGAACATGG + Intronic
1085406878 11:76268703-76268725 ATGGGTGGATGGATGGATGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085467413 11:76733686-76733708 ATGGGTGGATGGAAGGCAGATGG + Intergenic
1085690327 11:78658997-78659019 GTGGGTGGATGGATGGATGAAGG - Intronic
1086889965 11:92246124-92246146 GGCAGTGGATGGAGTGAAGAGGG + Intergenic
1087031327 11:93707870-93707892 TTGAGTGGAATGAGAGATGAAGG + Intronic
1087546005 11:99583955-99583977 TTGAGAGGGTGGAGCCAAGATGG - Intronic
1087552830 11:99673587-99673609 GAGAGTGGATGGTGGGAGGAGGG - Intronic
1087916245 11:103814952-103814974 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1088824576 11:113483019-113483041 ATGTATGGATGCAGGGAAGAGGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089032800 11:115350382-115350404 TTAAAGGGAAGGAGGGAAGAAGG + Intronic
1089197607 11:116703784-116703806 TTGGGTGGATGGGTGGCAGAGGG - Intergenic
1089647997 11:119892706-119892728 TTCAGTGGACGGAGCGCAGACGG - Intergenic
1089882968 11:121792501-121792523 TTGAGTGGAAGGTGGGCAAAGGG + Intergenic
1089887753 11:121844875-121844897 GGGAGTGGAGGGAGGGGAGAGGG - Intergenic
1090780220 11:130001665-130001687 TCGCGTGGCTGGAGGGCAGACGG + Intronic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091187346 11:133658421-133658443 GTGGGTGGATGGATGGATGATGG + Intergenic
1092492579 12:8959019-8959041 TTGAGAGGTTGGAAGCAAGATGG - Intronic
1092720677 12:11437500-11437522 TTGAGTGGAAGGATGGGAGGAGG + Intronic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1092945795 12:13452928-13452950 TTATGTGGATGGGGGGAAGGGGG - Intergenic
1093073528 12:14732733-14732755 TTGAGAGGATGGAGGAAAGGAGG + Intergenic
1093210576 12:16303354-16303376 TTGAGAAGAGGGAGGAAAGAAGG + Intergenic
1093318024 12:17675688-17675710 TTGAGTGAATGAGGGGAATATGG + Intergenic
1093803306 12:23400376-23400398 TTGAGAAGATAGAGGGAAGGTGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095051064 12:37554663-37554685 AGGAGTGGGTGGAGGGAACATGG + Intergenic
1095536238 12:43251397-43251419 TAGAGTGGAAGGAGAGATGATGG - Intergenic
1095625520 12:44309545-44309567 AGGAGTTGAGGGAGGGAAGAAGG + Intronic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096155499 12:49339331-49339353 GTGAGTGGAGGGAGGGAAAAGGG - Intergenic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1096884209 12:54700230-54700252 AGCAGTGGATGGAGGGAATAGGG - Intergenic
1097685091 12:62683797-62683819 TTGAGTGGAGGCTGGAAAGAAGG + Intronic
1098230313 12:68366442-68366464 TAGAGAGGATGTAGGGGAGATGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1099027668 12:77486133-77486155 ATGAGTGGAAGGAGGAGAGAGGG + Intergenic
1099289122 12:80753550-80753572 TTGGGTGGATGGAAGGTAGCTGG + Intergenic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1100722206 12:97371051-97371073 ATGAGAGGATGGAGGGGGGATGG - Intergenic
1100921335 12:99491530-99491552 GTGGGTGGAGGGTGGGAAGAGGG - Intronic
1100955394 12:99902569-99902591 TTAAGAGGATGGATGGAAGAGGG + Intronic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1101251484 12:102939947-102939969 CTGAGAGGATGGAGGCAAGCAGG + Intronic
1101288302 12:103339352-103339374 TTCAGAGGGTGGAGGGTAGAAGG - Intronic
1101368657 12:104102461-104102483 GAGAGTGGAGGGTGGGAAGAGGG - Intronic
1101401832 12:104394687-104394709 TTGAGGGGGTGGAGCCAAGATGG - Intergenic
1101530041 12:105565446-105565468 TTGAGGGGATGGGTGGGAGAAGG + Intergenic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1101776127 12:107795648-107795670 ATCAGAGGTTGGAGGGAAGAGGG + Intergenic
1101801074 12:108022370-108022392 GTGAGTGGATGATGGGCAGATGG - Intergenic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102452758 12:113053935-113053957 TGGAATGGATGGATGGAGGATGG + Intergenic
1102920646 12:116789195-116789217 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920697 12:116789423-116789445 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920740 12:116789597-116789619 GTGGGTGGATGGATGGTAGATGG + Intronic
1102920811 12:116789895-116789917 GTGGGTGGATGGATGGTAGATGG + Intronic
1103012784 12:117470068-117470090 ATGGGTGGATGGATGGATGAAGG - Intronic
1103012814 12:117470277-117470299 ATGGGTGGATGGATGGATGAAGG - Intronic
1103017775 12:117508943-117508965 ATGAGTGGATGGATGGTAGGTGG + Intronic
1103147637 12:118609344-118609366 TTGAGGGGAAGGAGGGAAAGAGG + Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103223478 12:119266553-119266575 TTGAGTTCAAGGATGGAAGAAGG - Intergenic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104678867 12:130735028-130735050 ATGAGTGGATGGAGAGAATGTGG - Intergenic
1104778450 12:131404809-131404831 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778506 12:131405026-131405048 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778521 12:131405088-131405110 TTGGGTGGATGGATGGATGATGG - Intergenic
1104778535 12:131405139-131405161 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778581 12:131405310-131405332 ATGGGTGGATGGATGGATGATGG - Intergenic
1104779334 12:131409819-131409841 GTGAATGGATGGATGGATGATGG - Intergenic
1104813936 12:131635130-131635152 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104813964 12:131635300-131635322 ATGGATGGATGGAAGGAAGAAGG - Intergenic
1104896304 12:132166644-132166666 GTGGGTGGATGGATGGATGATGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105635022 13:22208377-22208399 GTGATTGGCTGGAGGAAAGAAGG + Intergenic
1105707450 13:22977066-22977088 TGGGGTAGACGGAGGGAAGATGG + Intergenic
1105790313 13:23791856-23791878 TTGAGTGGTTGGTGGGACAAAGG - Intronic
1105936654 13:25106714-25106736 TTGACTGGAAAGAGGCAAGAAGG + Intergenic
1105966780 13:25391820-25391842 TTGAGTGGATGGAGGGTTCAGGG + Intronic
1106072411 13:26425107-26425129 TTAAGGTGATGGAGGGAGGATGG + Intergenic
1106171608 13:27293426-27293448 ATGAAAGGATGGAGGGAGGAAGG - Intergenic
1106246241 13:27953251-27953273 TGGAGTGGGTGGAGGTGAGAGGG + Intergenic
1106300763 13:28462731-28462753 TTGAGTGGCTGAGGGAAAGAGGG - Intronic
1106327430 13:28707400-28707422 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
1107185063 13:37508205-37508227 TTGTGTGGATGTGGTGAAGAGGG + Intergenic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1107823384 13:44306194-44306216 TTGAGAAGATGGAGGTGAGAGGG + Intergenic
1108022759 13:46145508-46145530 TTTAGTGGATGTAGGGATGAAGG + Intronic
1108698935 13:52927271-52927293 ATGAATGGAAGGAGGGAAAAAGG - Intergenic
1109536204 13:63722979-63723001 GTGAGAGGAAGGAGGGGAGATGG + Intergenic
1109539896 13:63763307-63763329 GTGAGAGGAAGGAGGGGAGATGG - Intergenic
1109645779 13:65253040-65253062 GAGAGTGGATGGTGGGAGGAGGG - Intergenic
1109864632 13:68246711-68246733 GTGGGTGGAGGGTGGGAAGAGGG - Intergenic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110581678 13:77136781-77136803 TTTAGAGGAGGGAGGGACGAAGG - Intronic
1110731593 13:78884886-78884908 ATGAGTGGTTAGAGGAAAGAGGG - Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112140365 13:96634754-96634776 TTTAGTGGGTGGTGGGAAGCAGG - Intronic
1112242806 13:97698768-97698790 TAGAGTGAATGGATGGAGGATGG + Intergenic
1112316847 13:98370566-98370588 TTGAGTGACTGGGGGGGAGATGG + Intronic
1113037214 13:106063167-106063189 TTGAATGGATGGATGGCTGAAGG + Intergenic
1113239247 13:108318054-108318076 GAGCGTGGATGTAGGGAAGAGGG - Intergenic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113883329 13:113641824-113641846 TTGAGAGGATTCTGGGAAGATGG + Intergenic
1114407517 14:22470615-22470637 TGAAGTGGATGTAGGGAAAAAGG - Intergenic
1114434307 14:22691473-22691495 ATGATTGGGTGGAGGGAAGGGGG + Intergenic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1116538160 14:46062454-46062476 TGGACTGGATGGATGGATGAAGG - Intergenic
1116636974 14:47409027-47409049 TGGAGTGGATTGGTGGAAGACGG + Intronic
1116704233 14:48276266-48276288 AAGAGAGGAGGGAGGGAAGAAGG - Intergenic
1116751371 14:48889698-48889720 TTGTGTGGATGGAAGGCAGTAGG - Intergenic
1117219602 14:53589814-53589836 TTGACTGGATTAAGGGAGGAGGG + Intergenic
1117561177 14:56940698-56940720 TGGAGTGGAGGGTGAGAAGATGG - Intergenic
1117732708 14:58739911-58739933 AGGAGAGGATGGTGGGAAGAAGG + Intergenic
1117911015 14:60638035-60638057 TGGAGTTGATGGAGGGAAAGCGG - Intergenic
1118098014 14:62561158-62561180 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
1118851637 14:69588255-69588277 TTGGATGGATGGATGGATGATGG - Intergenic
1119177709 14:72581380-72581402 TTGAGTGGCAGTGGGGAAGAAGG - Intergenic
1119444901 14:74655004-74655026 TTGAGTGGATGGGGAGAGGGAGG - Intronic
1119887246 14:78153194-78153216 TTTATTGGATGAAGGGAAGGGGG - Intergenic
1121096573 14:91221537-91221559 GTGGGTGGATGGAGGGATGGAGG + Intronic
1121413520 14:93763555-93763577 TGGAGTGGAAGGAAGGAGGAGGG - Intronic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1122011545 14:98753116-98753138 GTGAGTGGATGGATGGATGGAGG + Intergenic
1122053437 14:99075687-99075709 TGGATTGGTTGGAGGGAAGAAGG - Intergenic
1122140948 14:99662747-99662769 GTGGAAGGATGGAGGGAAGAAGG + Intronic
1122401095 14:101467862-101467884 TGGGGAGGATGGAGAGAAGAGGG + Intergenic
1122748647 14:103916799-103916821 GTGAGTGGGTGGAGGGAGGGAGG - Intronic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1122836870 14:104434840-104434862 TGGGGTGGACTGAGGGAAGATGG + Intergenic
1122886781 14:104713773-104713795 GTGAGTGGAGGGAGGGATGAGGG - Intronic
1122915586 14:104856900-104856922 GTGAGAGGAGGGAGGGAAAAAGG - Intergenic
1122958315 14:105083072-105083094 ATGGGTGGATGGATGGATGATGG - Intergenic
1122958337 14:105083153-105083175 ATGGGTGGATGGATGGATGATGG - Intergenic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1123819160 15:24010332-24010354 TTGAGTGGGGGGAGGGGGGACGG - Intergenic
1123871500 15:24579228-24579250 TGGAAAGGATGGAGGGAAAAAGG + Intergenic
1123979260 15:25584590-25584612 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1124162850 15:27289667-27289689 TTAAGTGAATGAATGGAAGATGG + Intronic
1124563879 15:30797901-30797923 GTGGGTGGATGGAAGGGAGAGGG + Intergenic
1124591419 15:31057103-31057125 TTGAGAGCATCCAGGGAAGATGG + Intronic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1125033661 15:35098201-35098223 ATGAGTGGAGGTGGGGAAGAAGG + Intergenic
1126723659 15:51608596-51608618 AAGAGTGGAAGGAAGGAAGAGGG + Intronic
1127045971 15:55026033-55026055 TGGAGTGGGTGGAAAGAAGAAGG - Intergenic
1127272378 15:57413242-57413264 AGGAATGGAGGGAGGGAAGAAGG - Intronic
1127371874 15:58349056-58349078 TTGTTTTGATGGAGGGAACAAGG + Intronic
1127756187 15:62094601-62094623 ATGAGAGAATGGAGGGGAGAGGG + Intergenic
1127998697 15:64171331-64171353 TTCACAGGAGGGAGGGAAGAAGG + Exonic
1128403563 15:67311902-67311924 ATGAGTGGACAGAGAGAAGAGGG + Intronic
1128559677 15:68656216-68656238 TTGACTTGATGGAGGGATGTGGG + Intronic
1128608885 15:69058328-69058350 TTGGGTGGATGGAAGAATGAAGG + Intronic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1128839400 15:70837485-70837507 TTGAGGGGATGGAGTAGAGAAGG - Intronic
1129182431 15:73885656-73885678 TGGGGTGGAGGGAGGGATGAGGG - Intronic
1129234268 15:74214345-74214367 GTGAGTGGAGGGAGGCAGGAAGG - Intergenic
1129696480 15:77743213-77743235 ATAGGTGGATGGAGGGAGGAGGG - Intronic
1129998982 15:80031092-80031114 TTAAGTGGATGGATAGATGATGG - Intergenic
1130094485 15:80845898-80845920 TCTAGAGGATGGAGGGAGGAGGG - Intronic
1130353607 15:83111232-83111254 ATGAGTGGATGGATGGAGTATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130615960 15:85408003-85408025 TTGAGTAGATGGTGGGAATTAGG + Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131175080 15:90204248-90204270 GTGAGTGGCAGGAGGAAAGAGGG - Intronic
1131231357 15:90661984-90662006 GTGAGTGCAAGGATGGAAGAAGG - Intergenic
1131757126 15:95577117-95577139 TTGAGTGGATAGAGAGTAGCAGG - Intergenic
1132003089 15:98199856-98199878 TGGAGTGGATAGAGAGAACAAGG - Intergenic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132030942 15:98438124-98438146 TTAGGTGGATGGATGGATGATGG + Exonic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132137820 15:99360780-99360802 ATGAGTGGCTGCAGGGAATAGGG + Intronic
1132484830 16:185402-185424 TTGGGAGGAGGGAGGGAGGAGGG + Intergenic
1132644692 16:993550-993572 GTGAGTGGGTGGATGGAGGATGG - Intergenic
1132653755 16:1033021-1033043 ATGAGTGGATGGATGATAGATGG - Intergenic
1132653816 16:1033321-1033343 ATGAGTGGATGGATGGATGATGG - Intergenic
1133204868 16:4227230-4227252 GTGGGTGGATGGATGGATGAAGG + Intronic
1133215630 16:4290602-4290624 GTGAGCTGATGGAGGGGAGACGG - Intergenic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133614032 16:7459074-7459096 GTGAGTGGATGGATGGATGATGG + Intronic
1133614041 16:7459126-7459148 GTGAGTGGATGGATGAATGACGG + Intronic
1133839289 16:9394109-9394131 TGGAAGGGAGGGAGGGAAGAAGG - Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134819996 16:17239330-17239352 GTGAGTGGATGGATGGATGATGG - Intronic
1134820024 16:17239468-17239490 GTGGGTGGATGGATGGATGATGG - Intronic
1135156633 16:20058473-20058495 TTGTGTTGGTGGAGGGAATAGGG + Intronic
1136071417 16:27789822-27789844 ATGGGTGGATGGATGGATGAAGG + Exonic
1136071446 16:27790037-27790059 ATGAGTGGATGGATGGCAAATGG + Exonic
1136107670 16:28041919-28041941 TTGAGTGGATGGAAGCCAGGGGG - Intronic
1136928391 16:34396361-34396383 TTTGGTGGATGGATGGATGATGG - Intergenic
1136976183 16:35015443-35015465 TTTGGTGGATGGATGGATGATGG + Intergenic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1138248919 16:55487699-55487721 TTGGGTGGATGAGGGGAGGATGG + Intronic
1138445405 16:57060168-57060190 TGGAGTGAATGGAGGGGAGGAGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138578424 16:57923525-57923547 TTGCCTGGAGGGAGGGAAAACGG + Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139067789 16:63339928-63339950 TTGACAGGAGGGAGGGATGAAGG + Intergenic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140035106 16:71365869-71365891 TTTAATGGATGGGGGGAAGGGGG - Intronic
1140109794 16:71994262-71994284 TTGAGTAGAGAGAGGGAAGTGGG - Intronic
1140187033 16:72783642-72783664 TTGGAAGGATGGAGGAAAGATGG + Exonic
1140225220 16:73071403-73071425 TTGAGCGGAGGGAGGGAGGGAGG + Intergenic
1140595476 16:76404043-76404065 GAGAGTGGAGGGTGGGAAGATGG + Intronic
1140678922 16:77364630-77364652 ATGAGTGGATGGATGGATGGTGG + Intronic
1140700178 16:77574486-77574508 TTGAGTGGGTGGAGGCAGGGAGG - Intergenic
1141096795 16:81168573-81168595 GTGGGTGGATGGATGGTAGATGG + Intergenic
1141421548 16:83921062-83921084 GTGGGTGGAAGGAAGGAAGATGG + Exonic
1141421552 16:83921081-83921103 ATGGTTGGATGGATGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421582 16:83921221-83921243 GAGGGTGGATGGAAGGAAGATGG + Exonic
1141475845 16:84272780-84272802 ATGAGTGGATGGATGAATGATGG - Intergenic
1141483748 16:84325084-84325106 ATGGATGGATGGAGGGATGAAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141517841 16:84558371-84558393 GTGGGAGGAGGGAGGGAAGAGGG - Intergenic
1141641970 16:85346741-85346763 GTGAGTGGATGGTGGGCAGGTGG + Intergenic
1142030869 16:87837892-87837914 TGGAGAGGATGGAGGGCAGGTGG + Exonic
1142124138 16:88401821-88401843 TTGGGTGGATGGATGGTGGATGG + Intergenic
1142130395 16:88429368-88429390 GTGAGTGGGTGGGTGGAAGAAGG - Exonic
1142559727 17:802889-802911 ATGGGTGGATGGAGGGCAGGGGG + Intronic
1142934477 17:3316743-3316765 TTAACTGGATGCAGGGAAGGAGG - Intergenic
1143301459 17:5913692-5913714 ATGGGTGGATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143863793 17:9909543-9909565 TGGAGTGGAGGGAGTGAGGAGGG - Intergenic
1143890253 17:10097327-10097349 TTGACTGAATGGGAGGAAGATGG + Intronic
1144044307 17:11441098-11441120 TTGAAGTCATGGAGGGAAGAAGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144355413 17:14441296-14441318 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144551767 17:16247097-16247119 TTAAGAAGAGGGAGGGAAGAAGG - Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1146260435 17:31417022-31417044 TGGGGTGGATGGAAGGAATATGG - Intronic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1147042922 17:37731833-37731855 GGGAATGGATGGAGGGGAGATGG + Intronic
1147142614 17:38467881-38467903 TTGAGTCGATGGAGGGATGGAGG - Intronic
1147620594 17:41864323-41864345 TCTAGTGGATGAAGGGGAGAAGG - Intronic
1148605628 17:48927144-48927166 TTGAGTGGGGGAAGGGGAGATGG - Exonic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149117521 17:53115688-53115710 TGGAGTGGATGCAGTGAAAAGGG - Intergenic
1150306154 17:64087220-64087242 GTGAGTGGAGGAAGGTAAGAAGG - Intronic
1150392097 17:64796145-64796167 ATGGGTGGATGGTGGGTAGATGG - Intergenic
1150822208 17:68444842-68444864 AGGAATGGAGGGAGGGAAGAAGG - Intronic
1150857862 17:68770467-68770489 TGGAGTGGGGGGAGGGAGGAAGG - Intergenic
1151050972 17:70978465-70978487 GAGGGTGGAAGGAGGGAAGAAGG + Intergenic
1151345720 17:73500199-73500221 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345753 17:73500321-73500343 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345782 17:73500436-73500458 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151345884 17:73500873-73500895 TGGAGGAGATGGAGGGAGGATGG - Intronic
1151599720 17:75098810-75098832 TGGAGAGGATGCAGGGCAGAAGG + Intronic
1151603691 17:75122971-75122993 TTAAGATGAAGGAGGGAAGAAGG - Intronic
1152033536 17:77858173-77858195 ATGAGTGGATGAATGGATGAGGG - Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152372087 17:79895000-79895022 TTGAATGGAAGGAAGAAAGAGGG - Intergenic
1152473719 17:80504106-80504128 ATGTGTGGATGGAGGGATGGTGG + Intergenic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152505652 17:80748002-80748024 TTGGGTGGATGGAGGGACTGCGG + Intronic
1152505666 17:80748057-80748079 TTGGGTGGATGGAGGGACTGCGG + Intronic
1152505680 17:80748112-80748134 TTGGGTGGATGGAGGGACTGCGG + Intronic
1152505839 17:80748654-80748676 TTGGGTGGATGGAGGGACTGCGG + Intronic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152767172 17:82147904-82147926 GTGGGTGGATGGATGGTAGATGG + Intronic
1152767205 17:82148019-82148041 GTGGGTGGATGGATGGTAGATGG + Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153493181 18:5670841-5670863 TGGAGTGGGTGGAGTGAAGAGGG + Intergenic
1153814641 18:8782033-8782055 TAGAGTGGAAGGAGGAAAGTTGG + Intronic
1153973818 18:10249238-10249260 TTAAGTGGAGGTAAGGAAGATGG + Intergenic
1154307813 18:13243522-13243544 ATGAGTGGATGGATGGATGATGG - Intronic
1155302780 18:24447143-24447165 TTGAGTGGATGGATGGATGAAGG + Intronic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156009990 18:32486095-32486117 TTAATTTGGTGGAGGGAAGAAGG + Intergenic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1156471705 18:37381154-37381176 TTGAGTGGATGAATGGTAGGTGG - Intronic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157307554 18:46528278-46528300 TTCAGTGCATGGAGAGGAGAAGG + Intronic
1157446417 18:47749595-47749617 TGGGGTTGATGGAGGGAAGGAGG + Intergenic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157886885 18:51377291-51377313 AGTAGTGGGTGGAGGGAAGATGG + Intergenic
1158067371 18:53426789-53426811 TTGAGTGGATGGATGAAGCACGG + Intronic
1159088520 18:63820873-63820895 TTTAGTGAATGGAGGAAGGAAGG + Intergenic
1160526551 18:79542048-79542070 GTGGGTGGATGGATGGATGAAGG - Intergenic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1160687608 19:443950-443972 GTGGGTGGATGGAGGGTGGATGG + Intronic
1160692182 19:465222-465244 TTGGGTGGATGGTGGAAGGAGGG + Intronic
1160692602 19:466801-466823 TTGGGTGGATGGTGGAAGGATGG + Intronic
1160910498 19:1471709-1471731 TTGGGTGGATGGAGCTCAGAAGG + Exonic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161347758 19:3776650-3776672 ATGAGTGGATGGTGGGTAGGTGG + Intergenic
1161347764 19:3776673-3776695 ATGAGTGGATGGTGGGTGGATGG + Intergenic
1161347775 19:3776716-3776738 ATGAGTGGATAGTGGGTAGATGG + Intergenic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1161449153 19:4334951-4334973 ATGAGTGGGTGGATGGATGATGG - Intronic
1161449207 19:4335193-4335215 ATGAGTGGATGGATGGATGATGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161681463 19:5681764-5681786 ATGGGTGGATGGATGGATGATGG - Intronic
1161916092 19:7229283-7229305 GCAAGTGGATGGAGGGATGATGG + Intronic
1161934631 19:7364105-7364127 GTGAGTGGAAGGAAGGAAGATGG + Intronic
1162085858 19:8248753-8248775 TTGGATGGATGGATGGATGATGG + Intronic
1162085912 19:8249017-8249039 ATGGGTGGATGGATGGATGATGG + Intronic
1162311573 19:9910873-9910895 GTGAATGGATGGAGAGAAAATGG + Intronic
1162634184 19:11953716-11953738 TTGAGTGGAAAGAGGGCAGCAGG + Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1163082340 19:14953085-14953107 GGGAGCAGATGGAGGGAAGAAGG + Intronic
1163238395 19:16043281-16043303 ACGAATGGATGGAGGGATGAAGG + Intergenic
1163238430 19:16043412-16043434 ACGAATGGATGGAGGGATGAAGG + Intergenic
1163238484 19:16043630-16043652 ATGAATGGATGAAGGGATGAAGG + Intergenic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163462554 19:17447954-17447976 TAGAATGGAGGGAGGGAAGGAGG + Intronic
1163609837 19:18295127-18295149 GTGGGTGGATGGATGGTAGATGG - Intergenic
1163803437 19:19382115-19382137 TTGAATGAAAGGAGTGAAGATGG - Intergenic
1164128013 19:22336264-22336286 TTGACTGGTTCGAGGAAAGAGGG + Intergenic
1164171483 19:22729128-22729150 TTGACTGGTTCGAGGAAAGAGGG - Intergenic
1164426419 19:28145929-28145951 CTGATTGGATGTGGGGAAGAAGG - Intergenic
1164429179 19:28172104-28172126 TTGAATGGATGAAGGGAATGCGG - Intergenic
1164767181 19:30781099-30781121 TTGACTGGCAGGAGGGAAAAGGG - Intergenic
1164868723 19:31625935-31625957 TGGAGTGGAGGCAGGGAGGAGGG - Intergenic
1165322456 19:35094387-35094409 ATGAGTGGATGGATGATAGATGG - Intergenic
1165922122 19:39305661-39305683 TTGGGGGGATGGAGGGACTACGG + Intergenic
1165998836 19:39865344-39865366 GTGGGTGGATGGAAGAAAGAAGG + Intronic
1166302743 19:41921637-41921659 TTGGGAGGAAGGAGAGAAGAGGG + Intronic
1166571393 19:43799101-43799123 GTGAGAGGAAGGAGGGAAGGAGG - Intronic
1166730965 19:45058893-45058915 ATGGGTGGATGGAGGGAGGGAGG - Intronic
1167022374 19:46887633-46887655 CTGAGTTGAAGGAGGGAAGTGGG - Intergenic
1167086913 19:47316369-47316391 ATGAGTGGATGCATGGATGATGG - Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167847408 19:52176002-52176024 TAGACTGGATGGTGGGAGGAGGG - Intergenic
1168330880 19:55567779-55567801 GTGAATGGATGGATGGATGATGG + Intergenic
1168330890 19:55567830-55567852 GTGAATGGATGGATGGATGATGG + Intergenic
1168394626 19:56037743-56037765 TTGAGACAATGGAGGGAAGTGGG + Intronic
925659178 2:6184280-6184302 TGGACAGGAAGGAGGGAAGAAGG + Intergenic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
926038311 2:9652471-9652493 TTGGGTGGATGGATGGATGGGGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
927088497 2:19692942-19692964 TTGAGTAAATGGATGGCAGATGG - Intergenic
927211325 2:20640801-20640823 TTGGCTGGATGGTGGGCAGAAGG - Intronic
927347308 2:22060591-22060613 TGGAGTGGATGCAGTGAAAAGGG + Intergenic
927399904 2:22698711-22698733 GAGAGTGGATGGGGGGAAGATGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927646978 2:24884063-24884085 GTGAGAGGCTGTAGGGAAGAGGG - Intronic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
928737591 2:34310003-34310025 TGGAGTGGGGGGAGGGGAGAGGG + Intergenic
928895873 2:36262874-36262896 TTGAGAGGATGGAGTGAGGGAGG + Intergenic
929009789 2:37429704-37429726 TGGAGTGGATGCAGTGAACAGGG - Intergenic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929086710 2:38175213-38175235 TGGAGAGGATGTGGGGAAGAGGG + Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929779426 2:44948362-44948384 TTCATTGGCTGGAGGGCAGAAGG + Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930330867 2:49981389-49981411 TGAAGGGGAGGGAGGGAAGAGGG + Intronic
931118569 2:59191458-59191480 TTGACTGGAGGGAGGTTAGACGG - Intergenic
931208378 2:60169341-60169363 TTGAATGTATGGAGGAAAGAAGG - Intergenic
931773397 2:65518655-65518677 AGGAAAGGATGGAGGGAAGAAGG - Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932008257 2:67949271-67949293 TTGACTGGATGAATGGAAAAAGG - Intergenic
932492688 2:72132009-72132031 GGGAGTGGCTGGAGGGAAGCTGG + Exonic
932604410 2:73155687-73155709 TTAAGAGGCTGGAGGGAAGGTGG - Intronic
932620363 2:73261456-73261478 GTGAGTGGATGTAGGAATGAGGG - Intronic
932892975 2:75611985-75612007 ATGAGAGGTGGGAGGGAAGACGG - Intergenic
932967698 2:76496918-76496940 TTGAGAGGATGGAGGCAGGAGGG - Intergenic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933656227 2:84889122-84889144 TTAATTGGATGTAGGCAAGAGGG + Intronic
934176048 2:89581439-89581461 TTGAATGGATGGAGGGACAGTGG + Intergenic
934286358 2:91655801-91655823 TTGAATGGATGGAGGGACAGTGG + Intergenic
934613919 2:95759781-95759803 ATGAATGGATGGATGGCAGATGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
934854227 2:97718918-97718940 TGGAGAAGATGGAGGGGAGAGGG + Intronic
935317883 2:101855205-101855227 TTGATGGGATGCAGGGTAGAGGG + Intronic
935451475 2:103214586-103214608 TTGGATGGATGGTGGGAGGAAGG - Intergenic
935782309 2:106518991-106519013 TTGAAAGGATGAAGGGAGGATGG - Intergenic
935965178 2:108465825-108465847 TTGCGTGGATGTGGGGAAAAGGG - Intronic
935985453 2:108668349-108668371 TGGAGGGGATGGGGAGAAGATGG - Intronic
936137883 2:109911996-109912018 TGGAGGGGATGGGGAGAAGATGG - Intergenic
936206814 2:110459489-110459511 TGGAGGGGATGGGGAGAAGATGG + Intronic
936956991 2:118032435-118032457 ATGGGTGGATGGATGGATGAAGG + Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937341682 2:121095414-121095436 TGGAGAGGCTGGAGGGAGGACGG - Intergenic
937434671 2:121870528-121870550 GTGAATGGATGGAGGCAAGTTGG - Intergenic
937556377 2:123162708-123162730 GTGAGAGGAAGGAAGGAAGAAGG - Intergenic
937879854 2:126857075-126857097 ATGACTGGAGGGAAGGAAGAAGG + Intergenic
938061631 2:128259738-128259760 TTGAGTAGTTGGTGGAAAGAAGG + Intronic
938112488 2:128578392-128578414 TGGAGAGGAGGGAGGGAGGAAGG - Intergenic
938208319 2:129442623-129442645 TTGATTGGTTGGGGGAAAGAAGG - Intergenic
938421653 2:131151761-131151783 GTGAATGGCTGGAGGGAAGGGGG + Intronic
938634698 2:133211041-133211063 TTGAGAGGAGTGAGGGGAGAAGG - Intronic
938702092 2:133888552-133888574 TGAAGTGCATGGAGGGCAGAGGG + Intergenic
938715863 2:134021274-134021296 TTGAGCAGATGGAGGTAAGGTGG - Intergenic
939292903 2:140218575-140218597 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
940365102 2:152839562-152839584 TTGTGTGGATGTGGGGAAAAGGG - Intergenic
940566610 2:155370103-155370125 TTGAGAGGATTCTGGGAAGACGG - Intergenic
941114323 2:161454277-161454299 TGGGAGGGATGGAGGGAAGAAGG - Intronic
941597208 2:167492133-167492155 TTCAGTGGAGGGAGAGAAGAGGG - Intergenic
941827903 2:169920316-169920338 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942703184 2:178737106-178737128 TAGAGAGGAGGGAGGGAAGGAGG + Intronic
942730977 2:179060544-179060566 TTGGATAGATGAAGGGAAGAGGG - Intergenic
942831400 2:180240546-180240568 TTGAATGAATGAAGGAAAGAAGG - Intergenic
943365980 2:186967872-186967894 TTGTGTGGATGGTGGGCAGCAGG + Intergenic
943384741 2:187187154-187187176 TGGGGTGGAGGGAGGGAGGAGGG + Intergenic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
943700204 2:190981016-190981038 TTTAGAGGAGGGAGGGAAAAGGG - Intronic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
945913042 2:215671166-215671188 TTGACTGGTTGGAGGAAAAATGG - Intergenic
946088987 2:217203803-217203825 TTGGGTGGATTGAGGAAAGATGG + Intergenic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946174429 2:217913743-217913765 TGGAGTGGCTGGAGGGAGAAGGG - Intronic
946176810 2:217927333-217927355 TGGAAGGGATGAAGGGAAGAAGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946202090 2:218076401-218076423 TGGGGTGGAAGGAGGGGAGAAGG - Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946303972 2:218845333-218845355 TAGAGTGCATGGGGGGATGATGG + Intergenic
946963121 2:225006017-225006039 TAGAGTGGAAAGAGTGAAGATGG + Intronic
947258982 2:228199277-228199299 TGGAGTGGGGGGAGGGAGGAGGG - Intergenic
947812913 2:233015417-233015439 ATGAGTGGATGGATGGATGGTGG - Intronic
947812933 2:233015500-233015522 ATGAGTGGATGGATGGATGGTGG - Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
949065863 2:241990054-241990076 ATGGGTGGATGGATGGATGATGG - Intergenic
1168975589 20:1963144-1963166 AGGGGTGGATAGAGGGAAGAAGG + Intergenic
1168984532 20:2036746-2036768 ATGAGTGGATGGTGGGGACATGG + Intergenic
1168984538 20:2036765-2036787 ATGGGTGGATGGTGGGTAGATGG + Intergenic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169603052 20:7284132-7284154 TTGAGTAGATGTATGGAAGATGG - Intergenic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171489227 20:25504793-25504815 ATGAGTGGCTGAAGGGTAGAGGG + Intronic
1171545590 20:25998115-25998137 AGGAGTGGGTGGAGGGAACATGG + Intergenic
1171564058 20:26161924-26161946 TGGAGTGGTGGGAGGGGAGAGGG - Intergenic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172321250 20:33996789-33996811 TTCAGGGGCTGGAGGGAGGAGGG - Intronic
1172632279 20:36386440-36386462 AGGAAAGGATGGAGGGAAGAAGG + Intronic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1172956406 20:38762652-38762674 TAGAGTTGGTGGAGGGATGACGG + Intronic
1173187366 20:40850695-40850717 TGGAAAGGAGGGAGGGAAGAAGG + Intergenic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173823986 20:46035613-46035635 TTGAATGGAGGGAGGGAAAGGGG + Intronic
1173833707 20:46111101-46111123 TTGAGGGGAAGGAGGGCAGGAGG + Intergenic
1173966861 20:47119117-47119139 GTGAGTAGTTGGAGGGGAGACGG - Intronic
1174279726 20:49430471-49430493 ATGAGTGGATGGATGGATGATGG - Intronic
1174355075 20:49992046-49992068 AGGACTGGAGGGAGGGAAGAAGG + Intergenic
1174422180 20:50406379-50406401 GTGGGTGGATGGATGGCAGATGG + Intergenic
1174577331 20:51545755-51545777 AGGAGTGGATGGAGGGTGGATGG + Intronic
1174747054 20:53073365-53073387 ATGAATGGATGGAGGGAGGGAGG - Intronic
1175165282 20:57039176-57039198 TTGGATGGATGGATGGATGATGG + Intergenic
1175278804 20:57788896-57788918 TTGAGTGGACCCAGGGAAGGAGG + Intergenic
1175372197 20:58499602-58499624 TGAGGTGGATGGAGGGAGGAAGG - Intronic
1175687949 20:61045066-61045088 GTGAGTGGTTGGATGGAGGATGG - Intergenic
1175781016 20:61682132-61682154 ATGGGTGGATAGAGGGTAGATGG + Intronic
1175817230 20:61889585-61889607 GTTAGTGGATGGATGGATGATGG + Intronic
1175817295 20:61889940-61889962 GTGAGTGGATGGTTGGATGATGG + Intronic
1175817396 20:61890471-61890493 GTGAGTGGATGGATGGATGATGG + Intronic
1175983997 20:62755228-62755250 AGGAGTGAATGGAGGGAAGGAGG - Intronic
1175984037 20:62755364-62755386 GAGGGTGGATGGAGGGATGAAGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1176659663 21:9622466-9622488 TGGAGTTGGTGGAGGGGAGATGG + Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1177264583 21:18765788-18765810 TGGAAGGGATGAAGGGAAGAGGG - Intergenic
1177400265 21:20594558-20594580 TGGGGTGGAGGGAGGGGAGAGGG - Intergenic
1177473587 21:21590481-21590503 TTCAGTGTATGGTGTGAAGAAGG - Intergenic
1177957232 21:27613931-27613953 GAGGGTGGAAGGAGGGAAGAGGG - Intergenic
1179549152 21:42132383-42132405 ATGAGTGGATGGATGGATGATGG - Intronic
1180371111 22:12037475-12037497 ATTAGTGGATGGAGGCAACATGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181528531 22:23502993-23503015 ATGAATGGATGGAGGGATGGGGG - Intergenic
1181536778 22:23550376-23550398 TTGGGAGGATGGATGGAGGATGG - Intergenic
1181537076 22:23551940-23551962 ATGGGTGGATGAATGGAAGATGG - Intergenic
1181591474 22:23888016-23888038 TTGGGTGGGTGGGGGGAACAGGG + Intronic
1181613633 22:24036671-24036693 ATGAATGGATGGAAAGAAGAAGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182005134 22:26953433-26953455 TTTAATGGATGGAGGGAGGAAGG - Intergenic
1182052766 22:27325622-27325644 GTGGATGGATGGATGGAAGATGG + Intergenic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303990 22:37072273-37072295 TTGCATGGATGGATGGATGATGG + Intronic
1183304136 22:37073044-37073066 ATGGGTGGATGGATGGATGATGG + Intronic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183724845 22:39582781-39582803 GTGAGTGTATGGGGGAAAGATGG - Intronic
1183742527 22:39676853-39676875 TTGAATGGATGGATGAACGAAGG - Intronic
1184043532 22:41958272-41958294 TTGAGTGGAGGCAGGGGAGCTGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184460774 22:44636701-44636723 GTGGGTGGATGGATGGATGATGG + Intergenic
1184731288 22:46372436-46372458 GTGAGTGGATGGATGGATGGGGG - Intronic
1184731304 22:46372486-46372508 GTGAGTGGATGGATGGATGGGGG - Intronic
1184878109 22:47288346-47288368 GTGGGTGGATGGAGGGAGGGAGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185104457 22:48859323-48859345 GTGGATGGATGGAGGGTAGAAGG - Intergenic
1185138874 22:49089300-49089322 TGGAGTGGACGGAGTGATGATGG - Intergenic
1185151615 22:49167146-49167168 AGGGGTGGAGGGAGGGAAGAAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949146756 3:710115-710137 GAGAGTGGAGGGAGGGAGGAAGG - Intergenic
949263306 3:2127392-2127414 TTAAGTGGAGGGAGGGAGGATGG + Intronic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949830926 3:8213248-8213270 AGGAAAGGATGGAGGGAAGAAGG - Intergenic
949905489 3:8855140-8855162 GTGAGTGGAAGAAGGGAGGAAGG - Intronic
950143325 3:10630307-10630329 GTGGGTGGAAGGTGGGAAGAGGG - Intronic
950321882 3:12063484-12063506 TTAAGTAAATGGATGGAAGATGG + Intronic
950565352 3:13766695-13766717 AGGAGTGGAGGGAGTGAAGATGG - Intergenic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
951046173 3:18040993-18041015 TAGAGTGGAGGGAGTGGAGATGG - Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952280704 3:31920582-31920604 TTAAGTAGATGGATGGTAGATGG + Intronic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
953508395 3:43509218-43509240 TGGGGTGGAGGGAGGGGAGAGGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954503480 3:51044425-51044447 TTCAGAGGATGGAGGGTAGGAGG + Intronic
955026154 3:55169609-55169631 GTGAGTGAATGGATGGATGAAGG - Intergenic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955911105 3:63861394-63861416 TTGAATGGATGGTGGGAGAAGGG - Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956395030 3:68816165-68816187 TGGAGTGGGGGGAGGGAGGAGGG + Intronic
956407522 3:68943721-68943743 TTGAGTGCAAGAAGGAAAGAAGG - Intergenic
957178029 3:76838230-76838252 GAGAGTGGATGGTGGGAGGAGGG + Intronic
958084228 3:88785718-88785740 TTCAGTGGATGGGGAGAATAAGG - Intergenic
958986433 3:100784386-100784408 TGGCGTGGATGTAGGGAAAAGGG + Intronic
959407969 3:105984777-105984799 TTGGGTGGAGGGAGGGTAAAAGG - Intergenic
959606612 3:108248537-108248559 TAGCCTGGATTGAGGGAAGAGGG - Intergenic
959788984 3:110333900-110333922 CAGAGTGGAGGGTGGGAAGAGGG + Intergenic
960796808 3:121496138-121496160 TTGAGGAGAAGGACGGAAGATGG - Intronic
961812063 3:129527696-129527718 TGGAGTGGAGGGAGGGAGGATGG - Intergenic
962071153 3:132034909-132034931 TGGAGTGGAGCGAGGGAGGAAGG + Exonic
962183387 3:133232354-133232376 GTGAGTGGATGCAAGGTAGAGGG - Intronic
962233485 3:133687195-133687217 TGGAGTGGGGGGAGGGGAGAGGG + Intergenic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962458977 3:135591495-135591517 TTGATTGGAGGGTGGGTAGAGGG - Intergenic
962791382 3:138814620-138814642 TTGAGTGGAGGAAAGGAAGGTGG - Intronic
963113370 3:141705140-141705162 TTGTGTGGATGCAGTGAACAGGG + Intergenic
963449234 3:145456889-145456911 TTGACTGGATATGGGGAAGAGGG - Intergenic
963471204 3:145743984-145744006 TTGAGTGGATGGTGGCAACCAGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
964815065 3:160708307-160708329 TGAAGTGGCTGGAGAGAAGAGGG - Intergenic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
965401310 3:168215985-168216007 TTGTGTGGAATGAAGGAAGAGGG + Intergenic
965652238 3:170946824-170946846 GAGAGAGGAGGGAGGGAAGAGGG + Intergenic
965682037 3:171261520-171261542 TTGGTTGGATGGATGGATGATGG + Intronic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966122810 3:176541917-176541939 TGGAGTGGATGCAGTGAAAAGGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967246519 3:187492172-187492194 TGGAGTGGCAGTAGGGAAGAAGG - Intergenic
968147209 3:196309609-196309631 TCCAGTGGAAGGAAGGAAGAAGG + Intronic
968594574 4:1475729-1475751 ATGAATGGATGGAAGGATGATGG + Intergenic
968935819 4:3609891-3609913 ATGAGTGGATGGAGGATGGATGG - Intergenic
969227274 4:5807236-5807258 ATGAGTGGATGGATGGAGGGAGG + Intronic
969424921 4:7118550-7118572 ATGAGTGGATGGATGGATGATGG + Intergenic
969424953 4:7118687-7118709 ATGGATGGATGGAGGGAAGGAGG + Intergenic
969424962 4:7118741-7118763 ATGAGTGGATGGATGGATGATGG + Intergenic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969523098 4:7690211-7690233 ATGAGTGGGTGGATGGATGATGG + Intronic
969523145 4:7690466-7690488 ATGAGTGGGTGGATGGATGATGG + Intronic
969548453 4:7848065-7848087 GTGAGTGGGTGGACGGAAGGAGG + Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969674088 4:8605451-8605473 ATGAATGGATGGACGGATGATGG - Intronic
970012730 4:11477972-11477994 GAGAGTGGATGGTGGGAAAAAGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970469683 4:16364693-16364715 CTGATTGGATGGATGGATGAAGG + Intergenic
970688647 4:18596920-18596942 AGGAGAGGATGGAGGAAAGAAGG + Intergenic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971709690 4:30094414-30094436 GAAAGTGGAGGGAGGGAAGAAGG + Intergenic
972160873 4:36225674-36225696 TTGAGAGGAAGGAGGCAGGAGGG + Intronic
972388470 4:38590277-38590299 TTGAGAGGATGTAAGGAAGGAGG - Intergenic
972565402 4:40264970-40264992 TTGAGAGGTTTGAAGGAAGATGG + Intergenic
972646743 4:40975157-40975179 GAGAGTGGATGGTGGGAGGACGG - Intronic
973556961 4:52092990-52093012 GAGAGTGGATGGTGGGAGGAGGG + Intronic
973733216 4:53843773-53843795 TTGAGTGGAGGTGGGAAAGAGGG + Intronic
973831064 4:54759470-54759492 TTGCGTGGATGTGGTGAAGAGGG - Intergenic
974011406 4:56610945-56610967 TTGTGTGGATGCAGTGAAAAGGG + Intergenic
974144059 4:57924077-57924099 TGGAGTGGGGGGAGGGGAGAGGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974377543 4:61097730-61097752 TTGGGTGGAGGGAGGGGGGAGGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975180187 4:71335065-71335087 TGAAGTGGAGGGAGGGAGGAAGG + Intronic
975199295 4:71566440-71566462 TTGAGAGGATGAAGGGCAAATGG - Intronic
975268761 4:72403942-72403964 TTGAGTCAATGGAGAGAAAAGGG + Intronic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
976117118 4:81739616-81739638 TGGAGTAGAAGGTGGGAAGAGGG + Intronic
976205452 4:82619521-82619543 TTGGCAGGATGGAGGGAGGAGGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977246653 4:94639376-94639398 TTGAGAGGATGAATGTAAGAAGG + Intronic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978349000 4:107801671-107801693 CTGAGTGGCTGCATGGAAGAGGG - Intergenic
978459913 4:108940406-108940428 TGGAGTGGGTTGAGGGAAGTGGG - Intronic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
978891625 4:113835216-113835238 TTGAGTGGATTCAGGGTGGAAGG + Intergenic
979171620 4:117607687-117607709 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
979345705 4:119584427-119584449 TTGATTTGATGGAGGAATGAGGG - Intronic
980094848 4:128478972-128478994 TGGAGTGGGTGGAGGGAAGTAGG - Intergenic
980670010 4:135993438-135993460 ATAAGTGGATGGAAAGAAGAAGG - Intergenic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981753876 4:148119919-148119941 CTGAGTGGTTGGATGGATGAAGG + Intronic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984266022 4:177498832-177498854 TAGCGTGGATGCAGGGAACAGGG - Intergenic
984446821 4:179848020-179848042 TGGAGTGGATGGATGGATTAGGG + Intergenic
984508698 4:180653356-180653378 GTGGGTGGAGGGTGGGAAGAGGG + Intergenic
984536215 4:180978965-180978987 TAGAATGGATTGAGGGATGAGGG - Intergenic
984863627 4:184261621-184261643 TTGGGTGGATGGTGGGAAGGGGG + Intergenic
984963556 4:185121329-185121351 AGGAGAGGATGAAGGGAAGATGG - Intergenic
985132031 4:186748437-186748459 GTGAGTGGAGGGTGGGAGGAGGG - Intergenic
985195863 4:187428682-187428704 TGGAGTGGATGCAGAGAAAAGGG + Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985415707 4:189733949-189733971 TGGAGTTGGTGGAGGGGAGATGG - Intergenic
985709152 5:1418599-1418621 ATGGGTGGATGGATGGATGATGG - Intronic
986194882 5:5528924-5528946 AAGAGTGGAGGGTGGGAAGAGGG - Intergenic
986344022 5:6817792-6817814 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
986741370 5:10708552-10708574 TTGAGTGGATGGAGATCAGCAGG - Intronic
986945359 5:13012067-13012089 TAGGGTGGAGGGTGGGAAGAGGG - Intergenic
986962051 5:13225922-13225944 GTGAGTGGCTGGAGGCAAGCAGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
987502205 5:18727469-18727491 TTCAGAGGATGGAGGGTGGAAGG - Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
988591018 5:32549576-32549598 TTGAGAGGAAGGAGGAATGAGGG - Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989560466 5:42844450-42844472 TTGGGTGGAGGGAGGGGGGAAGG - Intronic
990199823 5:53358902-53358924 TTGAGTGGATGCAGAGTAGAAGG + Intergenic
990278407 5:54224353-54224375 TGGAACTGATGGAGGGAAGAAGG + Intronic
990561747 5:56990506-56990528 GTGAGAGGAAGGAGGAAAGAAGG - Intergenic
990901641 5:60757069-60757091 TTTATTGACTGGAGGGAAGATGG + Intronic
991209397 5:64087183-64087205 TTGAGGGGGTGGAGCCAAGATGG + Intergenic
991651048 5:68854031-68854053 TAGAGTTGATGGTGGGAGGAGGG - Intergenic
991953628 5:71971006-71971028 TGGGGTGGATGCAGGGATGAGGG + Intergenic
992186414 5:74248957-74248979 AGGAATGGAGGGAGGGAAGAAGG + Intergenic
993970830 5:94418442-94418464 TTGGGAGGATGGAGGGGTGAGGG - Intronic
994448330 5:99906653-99906675 GTTAGTTGATGGAGGGAAAAAGG - Intergenic
994674968 5:102809473-102809495 TAGAGTGGATGGACTGGAGAAGG + Intronic
994947508 5:106414811-106414833 TGGAGAGGATGGAGGGAATGGGG + Intergenic
994956107 5:106535169-106535191 GGGAGTGGAGGGTGGGAAGAGGG - Intergenic
995246588 5:109942253-109942275 TTAATTGCATGGAGGGATGATGG + Intergenic
995565061 5:113425860-113425882 GGAAGTGGATGGAGGGAAGATGG + Intronic
995800522 5:115989001-115989023 GTGAGTGGATGGATGGATGTAGG - Intronic
996143521 5:119944940-119944962 GAGAGTGGAAGGTGGGAAGAGGG - Intergenic
996352756 5:122563656-122563678 TTAAGTAGATGGTGTGAAGATGG + Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
996595079 5:125191451-125191473 TTGAGAGGAGGGAGGGAGGGTGG - Intergenic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
997789033 5:136739792-136739814 GAGAGTGGAGGGTGGGAAGAGGG + Intergenic
997817574 5:137033660-137033682 TTGGGTGGGAGCAGGGAAGAAGG - Intronic
997896689 5:137725044-137725066 TGGAATGAATGGAGGGAAAAAGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998368896 5:141648917-141648939 ATGAGTGGGGGCAGGGAAGAGGG - Intronic
998844942 5:146299431-146299453 TGGTGTGGATGTAGGGAAAAGGG - Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
998949312 5:147375965-147375987 ATGAATGGATGGAGGGAGGCAGG - Intronic
999313581 5:150569483-150569505 TGGATTGGATGTAGGGCAGAAGG - Intergenic
1000173274 5:158725290-158725312 TGGGGTGGATGGTGGGAAGGAGG - Intronic
1000252198 5:159506346-159506368 TTTTGTGGAGGGAGGGAAGGGGG + Intergenic
1000397262 5:160788838-160788860 ATGAGTGGATGGATGGATGGTGG - Intronic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1000629377 5:163574322-163574344 GGGAATGGAGGGAGGGAAGAAGG - Intergenic
1000867388 5:166531801-166531823 TTGAGAGAAGGAAGGGAAGAAGG - Intergenic
1001045579 5:168368964-168368986 TGGAGTAGAAGGAGGGAAAATGG - Intronic
1001423966 5:171611406-171611428 CTGAGTGGATGGAAGGGATATGG - Intergenic
1001429068 5:171645357-171645379 TTGGGTGGCTGGTGGGGAGAAGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001751465 5:174134706-174134728 ATGGGTGGATGGATGGATGATGG - Intronic
1001802928 5:174559022-174559044 TGGAGTGGAAGGAAGGAAGGAGG - Intergenic
1001859383 5:175040135-175040157 TTAAGTTGAAAGAGGGAAGAAGG - Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002209235 5:177586344-177586366 TGGTGTGGATGGAGTGAACAGGG - Intergenic
1002892453 6:1347340-1347362 TTGAGTGGAGGGACAGAAGCGGG - Intergenic
1002918006 6:1544391-1544413 GTGAGTGGATGGATGAGAGAAGG + Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1004396039 6:15247442-15247464 TTGAGGGGAGGGAGGAAAGGGGG + Intronic
1004738603 6:18433553-18433575 CTGAGTGGAGGGAGAAAAGACGG + Intronic
1006299889 6:33188104-33188126 TTGAAAGGATGGATGGATGAGGG + Intronic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1007352477 6:41283956-41283978 GTGAGTGGGAGGAAGGAAGAGGG + Intronic
1007408631 6:41648960-41648982 GGGAGAGGAGGGAGGGAAGAAGG - Intronic
1007530584 6:42538402-42538424 TTGATTTGAAGGAGGGTAGAGGG + Intergenic
1008042956 6:46821316-46821338 TTCAGTGGGTGGTGGTAAGATGG - Intronic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1008620472 6:53266464-53266486 TGAAGTAGATGGAAGGAAGATGG + Intergenic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009330109 6:62408699-62408721 TTCAGAGGATGGAGGGGAGGAGG + Intergenic
1009430349 6:63559021-63559043 TTGACTGTATGGAGGCGAGAAGG + Intronic
1009892028 6:69696494-69696516 TTTAGGGGTTGGAGGGAGGAAGG - Intronic
1010401104 6:75447181-75447203 TTGAGTGCAAGTAGGGAAAAAGG + Intronic
1010941939 6:81929655-81929677 TAGGGTGGAGGGTGGGAAGAAGG - Intergenic
1011221436 6:85058355-85058377 TTGAGTTTGAGGAGGGAAGAAGG + Intergenic
1011398819 6:86937861-86937883 TGGAGTGGGTGGGGGTAAGAAGG - Intronic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012429895 6:99153324-99153346 TTGAGTTGATGTGGGGAAAATGG + Intergenic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1012666342 6:101975848-101975870 TTGAATGGATGGATGGATGGAGG - Intronic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013345156 6:109253009-109253031 ATGACTGGATGGGGGTAAGAAGG - Intergenic
1013747858 6:113367017-113367039 GTAAGTGCAAGGAGGGAAGAAGG - Intergenic
1013981205 6:116131820-116131842 TTCAGAGGGTGGAGGGTAGAAGG - Intronic
1015010745 6:128344254-128344276 TTAAGTGGATGGTGAGAGGATGG - Intronic
1016317657 6:142808313-142808335 GTGAATGGATGGAAGGAAGGAGG + Intronic
1016317776 6:142808776-142808798 ATGAATGGATGGAGGGAGGAAGG + Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017218447 6:151937388-151937410 TTGAGTGATTGGAAAGAAGACGG + Intronic
1017455397 6:154596970-154596992 TTGAGTGGCTGCAGGGAGGTAGG - Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018356002 6:163018113-163018135 TGTAGTGGAAGGAGGGAAGGGGG - Intronic
1018501277 6:164413303-164413325 TTCAGTGGAGGGAGGGGAGGAGG - Intergenic
1018544770 6:164923431-164923453 TTGAGTGCGTGGAGGAATGAAGG + Intergenic
1018868272 6:167761837-167761859 ATGGGTGGATGGAGGGATGGGGG - Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018871929 6:167790267-167790289 ATGGGTGGATGGTGGGGAGATGG - Intronic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019050819 6:169181985-169182007 TGGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019503668 7:1379390-1379412 ATGAGTGGTTGGATGGATGATGG + Intergenic
1019503685 7:1379523-1379545 TTGGATGGATGGTGGAAAGATGG + Intergenic
1019915081 7:4128046-4128068 TGGGGTGGATGCATGGAAGATGG - Intronic
1020351539 7:7224956-7224978 AAGACTGGAGGGAGGGAAGAGGG - Intronic
1020388067 7:7629541-7629563 TTGGCTGGATGATGGGAAGAGGG + Intergenic
1020472591 7:8556067-8556089 TATCCTGGATGGAGGGAAGAAGG - Intronic
1020954873 7:14728530-14728552 TGGAGTGGAATGAGGAAAGAGGG - Intronic
1021055894 7:16045734-16045756 TTGAGTTGATGGATGGCTGAAGG - Intergenic
1021414176 7:20362866-20362888 GTTAGTGGATGGAGGGATAAAGG + Intronic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023485897 7:40686577-40686599 TTGAGTGGAAGCAGATAAGATGG + Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1025296995 7:57783174-57783196 AGGAGTGGGTGGAGGGAACATGG + Intergenic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026438907 7:70425537-70425559 ATGAGTGGAAGGAGGGAGGGAGG + Intronic
1026450216 7:70522446-70522468 AGGAGTGGAGAGAGGGAAGAAGG - Intronic
1026531329 7:71199802-71199824 TTGGATGGATGGATGGATGATGG - Intronic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1026964565 7:74431017-74431039 TGGAGAGGATGGATGGATGAAGG - Intergenic
1027124301 7:75545029-75545051 TGGAGTGGATCAATGGAAGAGGG + Intronic
1028094763 7:86746219-86746241 TTAAGTGGAGGCAGGGAGGATGG + Intronic
1028385013 7:90244958-90244980 ATGAGTGGGTGGAGGGGTGAGGG - Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1029146124 7:98447381-98447403 GTGGGAGGATGCAGGGAAGAGGG + Intergenic
1029158670 7:98535409-98535431 TTGGGTGGCTGTAGGGAAGTGGG + Intergenic
1029200039 7:98833321-98833343 TGGGGAGGATGGAGGGAGGAGGG + Intergenic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1029991644 7:104967759-104967781 TTGAGTGGCTGGGTGCAAGAGGG - Intergenic
1030102204 7:105956356-105956378 CTGACTGGATGGATGGAAGGAGG + Intronic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1033158346 7:138975279-138975301 TTGAGTGTGTGGATGCAAGAGGG + Intronic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033966934 7:146986637-146986659 TGGCGTGGATGGAGTGAAGAGGG - Intronic
1034204948 7:149307255-149307277 GAGGGTGGAGGGAGGGAAGAGGG + Intergenic
1034286096 7:149883985-149884007 TTTAGTGGAGGGAGGGAGGGAGG + Intergenic
1034323901 7:150211757-150211779 TAGAGTGGAAGGAGGGAAACAGG - Intergenic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1034883646 7:154781049-154781071 ATGGGTGGATGGATGGATGATGG + Intronic
1035278874 7:157765105-157765127 GTGAGTGGATGGATGGGGGAAGG - Intronic
1035278963 7:157765501-157765523 GTGAATGGATGGAGGAAGGATGG - Intronic
1035278974 7:157765546-157765568 ATGGGTGGATGGAGGAAAAATGG - Intronic
1035279029 7:157765784-157765806 GTGAATGGATGGAGGAAGGATGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1035775798 8:2187040-2187062 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775807 8:2187106-2187128 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775815 8:2187172-2187194 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775824 8:2187238-2187260 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035775855 8:2187436-2187458 TGGAAAGGATGGAGAGAAGATGG + Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036149744 8:6286362-6286384 ATCAGTAGATGGAGTGAAGAAGG - Intergenic
1036505115 8:9347852-9347874 TGGATTGGATGAAGGGAATATGG - Intergenic
1036790344 8:11713585-11713607 CTGAGTGGATGAAAGCAAGATGG + Intronic
1037138761 8:15495128-15495150 TTGAGTGGATGAAGAAAATATGG - Intronic
1037234112 8:16696250-16696272 CTTAGTGGAGGGAGTGAAGAAGG - Intergenic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037841095 8:22245563-22245585 TGGAACGGATGGAGGGAAGGCGG - Exonic
1037921322 8:22808189-22808211 GTGGGTGGATGGATGGAAGTTGG - Intronic
1038007239 8:23442718-23442740 CTGAGTGAATGGAGGGATAAAGG - Intronic
1038040327 8:23718666-23718688 TGGAGTGAATGAGGGGAAGAGGG + Intergenic
1038271680 8:26080865-26080887 TTGGGTGGTGGCAGGGAAGATGG - Intergenic
1038600862 8:28940607-28940629 TTGAGTGGGTGGAGGAATAATGG + Intronic
1038642276 8:29338099-29338121 TTGGGAGGGAGGAGGGAAGATGG - Intronic
1039320096 8:36420045-36420067 ATGAGTTGAGGGAGAGAAGAAGG + Intergenic
1039518952 8:38154572-38154594 TTGAATGAATGGAGGGAGGGAGG - Intergenic
1039590144 8:38739335-38739357 TTGAGTGGATGAATGGCAGATGG - Intronic
1040672256 8:49705799-49705821 TGGGGTGGAGGGAGGGAGGAGGG - Intergenic
1040804024 8:51374332-51374354 TTGAGAGGATGAAGGCTAGATGG - Intronic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1041015064 8:53584904-53584926 TTGATTGGATGAGTGGAAGATGG - Intergenic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041604048 8:59759451-59759473 TTGAGCGCAGGGAGGGAACATGG - Intergenic
1041904084 8:63012767-63012789 TGCAATGGAGGGAGGGAAGATGG + Intergenic
1042013326 8:64275914-64275936 TTCAGAGGAAGGAAGGAAGAAGG + Intergenic
1042402085 8:68361162-68361184 TTGAAAGGAGTGAGGGAAGAAGG + Intronic
1042681718 8:71393436-71393458 TGGAGTGGTTGGAGGGGGGAGGG - Intergenic
1042818532 8:72904861-72904883 TGCAAAGGATGGAGGGAAGAAGG - Intronic
1043816441 8:84807648-84807670 TGGAGTGGATGCAGTGAATAGGG - Intronic
1043909484 8:85844613-85844635 ATGAGTGGGTGGATGGATGATGG + Intergenic
1043967313 8:86494048-86494070 TTGAGTGGCAGGAGGGAATGGGG + Intronic
1044272511 8:90264101-90264123 TTGAGCGGGTGGAGCCAAGATGG + Intergenic
1045024976 8:98078238-98078260 TTGATTGGATGGATGGATGAAGG + Intronic
1045733125 8:105264363-105264385 TAGACTGGAGGCAGGGAAGAGGG + Intronic
1046024682 8:108708021-108708043 TAGGGTGGATGGTGGGAGGAGGG - Intronic
1046702388 8:117416122-117416144 TTGAGTAGATGGAATGAGGATGG - Intergenic
1046886181 8:119369707-119369729 GAGAGTGGAGGGTGGGAAGAGGG + Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306842 8:123659393-123659415 ATAGATGGATGGAGGGAAGATGG - Intergenic
1047306855 8:123659457-123659479 ATGAGTGGATGGATAGATGATGG - Intergenic
1048161084 8:132022718-132022740 TTGATTAAAGGGAGGGAAGAAGG + Intergenic
1048187873 8:132260877-132260899 TTGGATGGATGGATGGATGATGG - Intronic
1048258805 8:132927275-132927297 TTGAATGGATGGAGGGAGGGAGG - Intronic
1048296966 8:133221512-133221534 ATGAGTGGATGGATAGATGACGG + Intronic
1048376280 8:133825398-133825420 TTGGTTGGATGGTGGGAAGAAGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048852453 8:138657981-138658003 TTACGAGGATGGAGGGAAGCAGG - Intronic
1048989351 8:139752250-139752272 TTGGATGGATGGATGGTAGATGG - Intronic
1048989507 8:139753014-139753036 TTGGATGGATGGATGGTAGATGG - Intronic
1048989552 8:139753205-139753227 TTGGATGGATGGATGGTAGATGG - Intronic
1048989562 8:139753251-139753273 TTGGATGGATGGATGGTAGATGG - Intronic
1049155279 8:141062482-141062504 ATGACTGGATGGAGAGAGGATGG + Intergenic
1049350867 8:142163930-142163952 ATGGGTGGATGGATGGAGGATGG + Intergenic
1049364284 8:142229217-142229239 GTGGGTGGATGGATGGATGATGG + Intronic
1049372011 8:142272445-142272467 ATGGGTGGATGGAAGGAGGAAGG - Intronic
1049372043 8:142272581-142272603 GTGGGTGGATGGAAGGAGGAAGG - Intronic
1049464984 8:142746981-142747003 ATGAGTGGATGGATGGATGGTGG + Intergenic
1049474756 8:142791674-142791696 ATGACTGGATGGATGGAGGATGG - Intergenic
1049474794 8:142791872-142791894 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049474802 8:142791899-142791921 ATGAATGGATGGAGGACAGATGG - Intergenic
1049474813 8:142791975-142791997 ATGACTGGATGGATGGAGGATGG - Intergenic
1049474899 8:142792572-142792594 GTGGGTGGATGGATGGAGGATGG - Intergenic
1049474907 8:142792599-142792621 ATGAATGGATGGAGGACAGATGG - Intergenic
1049478847 8:142810487-142810509 ATGAGTGGTTGGAGGGGTGAAGG - Intergenic
1049655141 8:143793932-143793954 TGGAGCAGCTGGAGGGAAGATGG - Exonic
1050501704 9:6304976-6304998 TTGAGTAGGAGGAGGGAAAAAGG + Intergenic
1050752935 9:8962418-8962440 TGGATTGGAAGGTGGGAAGATGG + Intronic
1050753349 9:8967894-8967916 TGGGGTGGAGGGAGGGAGGAGGG - Intronic
1050965484 9:11795959-11795981 TTGAGAGGAGGGAGCCAAGATGG - Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051481298 9:17564310-17564332 TTTAGAGGATGGAAGAAAGAAGG - Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051923178 9:22291600-22291622 TGGAGAGGATTGAGGGAAGCAGG + Intergenic
1052385285 9:27815890-27815912 TTGAGAGGATGCAGAGAAAAGGG + Intergenic
1052635025 9:31092239-31092261 TTCAGAGAATGGAGGGTAGAAGG - Intergenic
1053518729 9:38754827-38754849 TTGAATGGAGGGAGGGAGGGAGG - Intergenic
1055003014 9:71474785-71474807 TTCTGTGGATGGAGGTAACAAGG + Intergenic
1055113775 9:72585833-72585855 TGGAGTGGATGGGGCGTAGATGG + Intronic
1055479705 9:76697404-76697426 TCGAGTGGTTGGAGGCCAGAGGG - Intronic
1055883380 9:81030449-81030471 TTCAGTGGTAGGAAGGAAGATGG + Intergenic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056939843 9:90945816-90945838 TTGGGTGGAGGGATGGAAGGAGG - Intergenic
1057181092 9:93030838-93030860 ATGCGTGGATGGATGGATGAGGG + Intronic
1057181132 9:93031081-93031103 ATGGGTGGATGAAGGGATGATGG + Intronic
1057462044 9:95271897-95271919 TTGATGGGATTGATGGAAGAGGG - Intronic
1057568703 9:96187041-96187063 AAGAGAGGATGGAGGGGAGAGGG - Intergenic
1058017247 9:100048171-100048193 TTGGGTGGGTGGAGGGGGGAGGG + Intronic
1058227813 9:102388237-102388259 TTTAGGGGATGGATGGGAGAGGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1059074982 9:111183304-111183326 TGGCGTGGATGCAGTGAAGAGGG - Intergenic
1059252238 9:112895832-112895854 GTGGGTGGATGGATGGATGATGG - Intergenic
1059309359 9:113377422-113377444 TTGAGTGGGAGGAGGGGAGTTGG + Intergenic
1059365491 9:113783590-113783612 TTGATTGGATGGATGAGAGATGG + Intergenic
1059493402 9:114688866-114688888 TTGAGTGGAGGGTGGGGAGAAGG - Intergenic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060497555 9:124129579-124129601 TTGAGTGGATGGAAGTTAGTGGG + Intergenic
1060742526 9:126109010-126109032 TTCAGTAGGTGGAGGGAGGATGG - Intergenic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061207869 9:129174924-129174946 CCCAGTGGATGGAGGGAGGAAGG - Intergenic
1061244866 9:129396370-129396392 ATGAGAGGATGGATGGTAGATGG + Intergenic
1061244927 9:129396664-129396686 ATGGGTGGAAGGATGGAAGATGG + Intergenic
1061256510 9:129456707-129456729 TTGGCTGGATGGATGGATGATGG + Intergenic
1061417491 9:130454991-130455013 GTGAATGGATGGATGGATGATGG - Intronic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061507720 9:131040945-131040967 ATGAGTGGATGGATGGAGGGAGG + Intronic
1061783075 9:133007193-133007215 TTGGGTGGATGGATGGTGGATGG + Intergenic
1061980985 9:134103521-134103543 TTGGATGGATGGATGGTAGATGG - Intergenic
1062017907 9:134301002-134301024 AAGAGTGGAAGGAAGGAAGAAGG + Intergenic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062092520 9:134685868-134685890 GTGGGTGGATGGATGGATGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062172235 9:135141309-135141331 ATGAGTGGATGGATGAATGATGG + Intergenic
1062201294 9:135304209-135304231 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201357 9:135304492-135304514 TTGAGTGGATGGATGGATGATGG + Intergenic
1062201371 9:135304545-135304567 ATGAGTGGATGGATGGATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062248010 9:135579607-135579629 AAGAATGGATGGATGGAAGATGG - Intergenic
1062281260 9:135752763-135752785 ATGAGTGGATGGGTGGATGATGG + Intronic
1062281306 9:135752994-135753016 ATGAGTGGATGGATGGATGGAGG + Intronic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1062520837 9:136957243-136957265 GTGGGTGGATGGATGGATGATGG + Intronic
1062520958 9:136957636-136957658 GTGGGTGGATGGATGGATGAAGG + Intronic
1203637222 Un_KI270750v1:124309-124331 TGGAGTTGGTGGAGGGGAGATGG + Intergenic
1203651901 Un_KI270751v1:132768-132790 ATTAGTGGATGGAGGCAACATGG - Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1185495218 X:549578-549600 GTGGGTGGATGGATGGATGAAGG - Intergenic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185638980 X:1575916-1575938 TTTAATGGATGGAGGGTGGATGG + Intergenic
1185762686 X:2700719-2700741 ATGAGTGGATGGTGGACAGATGG - Intronic
1185840520 X:3385577-3385599 ATGAATGGATGGATGAAAGACGG + Intergenic
1185908414 X:3959580-3959602 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186942846 X:14529583-14529605 TGGAGTGGGTGGGGGGAAGAGGG - Exonic
1187122756 X:16425208-16425230 TTGGGTGGTTGGAGGGAAGGAGG - Intergenic
1187662768 X:21568600-21568622 TTTTTTTGATGGAGGGAAGAGGG + Intronic
1187755870 X:22525546-22525568 GAGAGTGGAGGGAGGGAGGAGGG + Intergenic
1187990771 X:24869757-24869779 GTTTGTGGATGGAGGAAAGAAGG - Intronic
1188228016 X:27625858-27625880 GTGAGTGGAGGGTGGGAGGAGGG + Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188799260 X:34506943-34506965 TTGAGTGGAAGAATGGAAGGGGG - Intergenic
1189017831 X:37302685-37302707 TTGAGTGGCTGGATGGGTGAGGG + Intergenic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1189525409 X:41814591-41814613 TTGGGTGGAGGGAGGGGGGAGGG + Intronic
1189733507 X:44046367-44046389 TGGAGTGGATGCAGTGAACAGGG - Intergenic
1189760923 X:44320789-44320811 AGGAGTGAATGGAGGGGAGAAGG - Intronic
1190055040 X:47176350-47176372 GAGAGCGGATGGAGGGAAGAAGG - Intronic
1190212684 X:48460544-48460566 AGGAGTGGATGGATGGATGAAGG - Intronic
1191046242 X:56140602-56140624 GAGGGTGGATGGTGGGAAGAGGG + Intergenic
1191056107 X:56243002-56243024 TTGACCTGATGGAGAGAAGAAGG - Intronic
1191745737 X:64484499-64484521 TTGAGAGGGTGGAGCCAAGATGG - Intergenic
1191845686 X:65546022-65546044 TTGAAAGGATGGAAAGAAGAGGG - Intergenic
1192198961 X:69051794-69051816 ATGGGTGGATGGATGGAAAATGG - Intergenic
1192488036 X:71547802-71547824 TTGGGGGGAGGGGGGGAAGAAGG - Intronic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1193356518 X:80525412-80525434 TTGAGGGGTTTGAGGGATGAGGG - Intergenic
1193512771 X:82426164-82426186 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1193620249 X:83744415-83744437 TTGACTGAATGGATGGAAAAGGG - Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193752927 X:85369439-85369461 GTAAGTGAATGGAGGAAAGATGG - Intronic
1194910517 X:99637195-99637217 TTGATTGGATTGAAGGATGAGGG + Intergenic
1194938877 X:99985377-99985399 TTGAACAGATGCAGGGAAGAAGG - Intergenic
1195681749 X:107552479-107552501 TTGAGTGGAAGGAGAGAGGTAGG + Intronic
1195784969 X:108509278-108509300 GAGAGTGGAGGGTGGGAAGAGGG + Intronic
1195811519 X:108837253-108837275 TTGAGTAGATGGAGGAAAATGGG - Intergenic
1195977374 X:110542273-110542295 TTCAGAGGATGGAGGGAGGGAGG - Intergenic
1195994587 X:110719103-110719125 TTGACTGGATAGAAGGAAAAAGG + Intronic
1196060380 X:111402082-111402104 TTGAGAGGATGGAAAGATGAAGG - Intronic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197265961 X:124371779-124371801 TTGATTGTATGGTGGGAAGTTGG + Exonic
1197357251 X:125450558-125450580 TTGGGTGGGTGGGGGGCAGAGGG + Intergenic
1197377476 X:125699153-125699175 GAGAGTGGATGGTGGGAGGAGGG - Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1197816852 X:130506586-130506608 TTGAAGGGAGGGAGGAAAGAAGG - Intergenic
1197971839 X:132122476-132122498 TTAAGTGGCTGGTGGGATGATGG - Intronic
1198415184 X:136412716-136412738 TTGAGTGGATGTAGGAAGCAAGG + Intronic
1198890548 X:141390892-141390914 TGGAGTGGAAGGTGGGAAGAGGG - Intergenic
1199298662 X:146187363-146187385 TGGGGTGGAGGGAGGGAAGGGGG - Intergenic
1199450717 X:147976227-147976249 TTGAGTGAATGGATGGATAAAGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200586036 Y:5005486-5005508 TTTACTGGATAGATGGAAGATGG - Intronic
1200712239 Y:6497051-6497073 TGGAGTGGGGGGAGGGGAGAGGG - Intergenic
1200778270 Y:7190159-7190181 TGGGGTGGGTGGAGGGGAGAGGG - Intergenic
1201144719 Y:11057975-11057997 ATGAGTGGATGGAGGGAGGGAGG + Intergenic
1201289470 Y:12408675-12408697 ATGGGTGGATGGATGGATGATGG - Intergenic
1201901220 Y:19047199-19047221 TTGAGTGGATGGATGAATGGCGG + Intergenic