ID: 977743259

View in Genome Browser
Species Human (GRCh38)
Location 4:100512979-100513001
Sequence ATGTAACTTCACCAATGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977743259 Original CRISPR ATGTAACTTCACCAATGAAA AGG Intronic
901400586 1:9012781-9012803 ATGAAACTGCACCAACAAAAAGG + Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903271425 1:22190677-22190699 AAGTAACTTTCCCAAGGAAATGG - Intergenic
906404578 1:45531579-45531601 TTGCAACATCACCAATGAATAGG - Intergenic
906438331 1:45816543-45816565 AGGTAACTTCAGCAAAGAAATGG + Intronic
907182122 1:52579920-52579942 ATGAAACATTACCAATAAAATGG + Intergenic
908216210 1:61955843-61955865 ATTTGGCTTCACTAATGAAATGG - Intronic
908591589 1:65642585-65642607 TTGTAACTTGATGAATGAAATGG + Intergenic
909137546 1:71820445-71820467 ATTTAATTTCCCCAATCAAATGG - Intronic
909969872 1:81969333-81969355 AAATAAATTCAGCAATGAAAAGG - Exonic
910397896 1:86810044-86810066 AAGTACCTTAACCAATGTAAGGG - Intergenic
910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG + Intronic
912465330 1:109868872-109868894 ATGTAAGGTCTCCAAGGAAATGG + Intergenic
913207051 1:116548782-116548804 TTGTCACTTCACCAGTGAAATGG - Intronic
913355377 1:117915517-117915539 ATGTAATTTCAGAAATTAAAAGG + Intronic
914780068 1:150777579-150777601 TTGTAACTGTACCAATGAGATGG + Intergenic
915383593 1:155468290-155468312 GGTTAACTTCACCAATGATAAGG - Intronic
916899509 1:169205557-169205579 CTGTTTCTTCACCAATAAAACGG - Intronic
920637728 1:207720571-207720593 ATGTAACTGGGCCATTGAAATGG - Intronic
921118930 1:212119805-212119827 ATGTGACTTCACCGAAGACAGGG + Intergenic
921802801 1:219420281-219420303 ATTTAATTTCACCAAATAAAAGG + Intergenic
923922498 1:238583543-238583565 AGGTAACTTCTCCACTGACAAGG - Intergenic
1064829641 10:19447895-19447917 ATGTAACTTCTGTATTGAAAGGG - Intronic
1065022850 10:21515297-21515319 ATGTAGCATCAGCAGTGAAAAGG - Exonic
1068124531 10:52822776-52822798 ATTTTTCATCACCAATGAAATGG + Intergenic
1068588213 10:58824635-58824657 TTGTAACTTCACAATTCAAAAGG + Intronic
1072429508 10:95358303-95358325 ATATAAAATCATCAATGAAAGGG + Intronic
1077947608 11:6918698-6918720 ATGTAGCTGCAACAGTGAAAGGG - Intergenic
1079100913 11:17541718-17541740 GGGTAACTTCACAAATCAAAGGG + Intronic
1080628049 11:34049108-34049130 ATGTCAGAACACCAATGAAATGG + Intergenic
1081101973 11:39013537-39013559 ATGTAACTTCAAGCATGAGAAGG - Intergenic
1081525104 11:43922568-43922590 AAGGAGCTTCCCCAATGAAATGG - Intergenic
1085911453 11:80831743-80831765 ATCCAACCTGACCAATGAAATGG - Intergenic
1086887210 11:92219934-92219956 ATGTTTCTTTACCAATCAAAGGG - Intergenic
1087258666 11:95985683-95985705 ATGTATTTTCACAAGTGAAAAGG - Intronic
1088013679 11:105034418-105034440 TTGTACCTTCACCCATGGAACGG + Exonic
1088014683 11:105044602-105044624 TTGTACCTTCACCCATGGAATGG + Exonic
1088952191 11:114583177-114583199 ATTTAAATTCTCCAATAAAAAGG + Intronic
1090161299 11:124498415-124498437 ATGTAACTTCAAGAAGAAAAAGG + Intergenic
1091480748 12:827894-827916 ATGTCACTTCATGAAAGAAATGG + Intronic
1092610907 12:10171925-10171947 ATGTAAATTCACCGAAGAATGGG - Intronic
1092677740 12:10941425-10941447 ATGTAACTTTGACACTGAAATGG - Intronic
1092865724 12:12759201-12759223 ATGTAACTGAAACAACGAAAAGG + Intronic
1093379506 12:18475522-18475544 ATGTAACTTTACCAACGATGGGG + Intronic
1093890971 12:24520668-24520690 AGTTAAATTCACCAATGAAAAGG + Intergenic
1094130082 12:27065143-27065165 ATGGAACTTCAGGAATGAATGGG - Intronic
1098604689 12:72375717-72375739 ATGTAACTTAATAAATGAGAAGG + Intronic
1099292972 12:80794853-80794875 ATGTAAATGCTCCAGTGAAAAGG + Exonic
1099338274 12:81393613-81393635 ATTGAACTTCACAATTGAAAGGG - Intronic
1099839758 12:87950736-87950758 ATTTATCTTCCCCAATGAAAGGG + Intergenic
1103835135 12:123812935-123812957 ACTTAACTTGACCAATGGAAAGG - Intronic
1104340113 12:127941106-127941128 ATGCAACTTCACAAATTAATTGG + Intergenic
1108834761 13:54529563-54529585 ATGTCACTTCCCAAATTAAAAGG + Intergenic
1109730876 13:66412050-66412072 ATGTGTCTTCTCCCATGAAAAGG - Intronic
1110716102 13:78706064-78706086 ATGTAAATTAGCCAGTGAAATGG - Intergenic
1112106353 13:96244110-96244132 ATGTAATTTTCCCAATGGAATGG - Intronic
1112148832 13:96733653-96733675 AGATTCCTTCACCAATGAAATGG + Intronic
1113214713 13:108026171-108026193 ATATGACAGCACCAATGAAATGG - Intergenic
1114570788 14:23666410-23666432 ATGTATCCTTACCAGTGAAATGG - Intergenic
1114575255 14:23707007-23707029 GGGGCACTTCACCAATGAAAAGG + Intergenic
1115992132 14:39161181-39161203 TTGTATCTTCACCCTTGAAAAGG + Intronic
1116970869 14:51064402-51064424 GTGTAACTACTCCAATTAAAAGG + Intronic
1117375552 14:55115443-55115465 AGGTTACTTCAACAGTGAAATGG + Intergenic
1118626744 14:67666305-67666327 ATGTAACTACATAAATGAAAGGG + Intronic
1119771317 14:77221877-77221899 ATGTGACATCACCTATGCAACGG - Intronic
1120092722 14:80351972-80351994 ATGTATCCTCACAAAAGAAAGGG - Intronic
1120358511 14:83464319-83464341 ATGAAACTTGGCCAATGCAAGGG + Intergenic
1120495060 14:85224600-85224622 TAGTAACTTCAACAATAAAAAGG + Intergenic
1120591209 14:86374892-86374914 ATGTAACTTAACAAATTGAAGGG - Intergenic
1120856686 14:89218610-89218632 ATTGAATTTCAGCAATGAAAAGG - Intronic
1121618648 14:95331261-95331283 AGCTCATTTCACCAATGAAAAGG + Intergenic
1125385545 15:39132514-39132536 ATATAGTTTTACCAATGAAATGG - Intergenic
1127796694 15:62444449-62444471 ATATAACTTAACCTATAAAATGG + Intronic
1129362906 15:75035510-75035532 ATGTCTCTTCAGCAAAGAAAAGG + Intronic
1130689410 15:86067862-86067884 GTGTAACATCAACAGTGAAATGG + Intergenic
1135426649 16:22342883-22342905 ATGGAACTTCAGCATTAAAAAGG + Intergenic
1139737726 16:69006419-69006441 ATGAAACTTTGCGAATGAAAGGG - Intronic
1141522117 16:84587589-84587611 ATGTAATTTCATAAATGATATGG - Intronic
1143122282 17:4616113-4616135 ATGAAGCCTCACCAAGGAAATGG - Intergenic
1143829939 17:9643570-9643592 ATATAGCTTGACCAATGAAATGG - Intergenic
1146796024 17:35781649-35781671 ATGTAACTTTATCAGTGAGAAGG - Intronic
1149481289 17:57005432-57005454 ATGTCATTTAATCAATGAAAGGG - Intronic
1150443435 17:65210232-65210254 ATGCAACTTCGCCAACAAAAGGG + Intronic
1150889925 17:69135956-69135978 AAATAAGTTCAGCAATGAAATGG + Intronic
1153011434 18:543183-543205 ATGTCACTTGAGAAATGAAATGG + Intergenic
1155026787 18:21947901-21947923 ATGGAACTTCAGCCATAAAAAGG + Intergenic
1155327215 18:24676700-24676722 ATGTAACTTCATCAGTGCCATGG - Intergenic
1157990683 18:52492090-52492112 AAGTAATTTCACAAATGAGAGGG + Intronic
1159126881 18:64234477-64234499 ATTTATCTTCTCCAATGCAAAGG + Intergenic
1159634500 18:70788829-70788851 GTGTTACTACACCAATGGAAGGG - Intergenic
1159774949 18:72593201-72593223 AAGAAACTTAACCAAAGAAATGG - Intronic
1160395571 18:78569041-78569063 ATCTAAATACACCAATTAAAAGG + Intergenic
1160831375 19:1106251-1106273 GTGGAACTTCACCAAGGTAAGGG + Exonic
1162879962 19:13651163-13651185 ATGTAATTTCATCAAAAAAAGGG + Intergenic
1164235345 19:23327364-23327386 ATGTATCTTCAGAAATAAAAGGG + Intronic
1164392608 19:27838811-27838833 ATGTAACTTACCCAGTGAGAGGG + Intergenic
1168523887 19:57073583-57073605 AAGTAACGTCACCTATGAAATGG - Intergenic
927805867 2:26145989-26146011 ATGGAAGTTCACCAACAAAAAGG + Intergenic
927999768 2:27513022-27513044 ATGTAGCATCACCAATAAAGGGG - Intronic
928528708 2:32168484-32168506 TAGTAACTTCACTAATGACAAGG - Intronic
930061764 2:47295497-47295519 AAGTAACTACACAAAGGAAAAGG - Intergenic
930375282 2:50558002-50558024 TTGTATTTTCACCCATGAAAGGG + Intronic
931615815 2:64156426-64156448 ACGTTGCCTCACCAATGAAAGGG + Intergenic
931937889 2:67218588-67218610 ATGTAAATTAACAACTGAAAAGG + Intergenic
933075013 2:77913215-77913237 ATGTAACATCCCCATTGAAATGG + Intergenic
936867282 2:117088902-117088924 ATGGGACTTCTCAAATGAAAGGG - Intergenic
939390968 2:141569649-141569671 AAATAACTTCACCATTAAAAAGG - Intronic
941174432 2:162179510-162179532 ATGTAAGTTCATCAAAGGAATGG - Intronic
941230618 2:162907401-162907423 ATGTGACACTACCAATGAAAAGG + Intergenic
941289817 2:163661584-163661606 ATGTCATTTCACCATTGATAAGG + Intronic
941863264 2:170307346-170307368 ATGTACTTTCACCAAAGAACAGG + Intronic
942413208 2:175733144-175733166 ATTTAAGTTAACCAATTAAAAGG - Intergenic
943662725 2:190576447-190576469 ATGTAACTTGTTAAATGAAACGG + Intergenic
943875722 2:193065175-193065197 AGGCAATTTGACCAATGAAATGG - Intergenic
947024907 2:225726428-225726450 AAGTAACAACACCACTGAAAGGG + Intergenic
947045134 2:225973470-225973492 ATGTAGCTGCAGCAATGAAGAGG - Intergenic
947045487 2:225978238-225978260 ATGAAAATTTACCAATAAAAAGG - Intergenic
1170039597 20:12025951-12025973 ATGGAAGTACAACAATGAAAGGG - Intergenic
1171568377 20:26218982-26219004 AGATAAATTCACAAATGAAATGG + Intergenic
1172289158 20:33763153-33763175 ATGTAACTTAAACATAGAAAAGG - Intronic
1173990213 20:47296526-47296548 ATGTCACCTCAACAATGAGATGG + Intronic
1178717253 21:34977020-34977042 ATTTATCTTCACCAATTCAATGG + Intronic
1178739886 21:35189171-35189193 GTGTAAACTCACCAAAGAAAGGG + Intronic
1182009575 22:26989351-26989373 ATGCACATACACCAATGAAAAGG - Intergenic
1184911332 22:47536427-47536449 ATGAAACATTACCTATGAAAAGG - Intergenic
949226647 3:1702907-1702929 ATGTAACCTAACATATGAAAAGG + Intergenic
949959586 3:9301099-9301121 ACGAAACTTCACCAAGGGAAGGG - Intronic
951045566 3:18034192-18034214 ATGTTACTTGACCACAGAAAGGG + Intronic
951908540 3:27726474-27726496 ATGTAACATCAACAAAGAAAGGG - Intergenic
952802319 3:37307138-37307160 AAGTAACTTCAGCAAAGACAAGG - Intronic
956386259 3:68723228-68723250 AGGAAAATTCACCAAAGAAATGG - Intergenic
957110468 3:75949368-75949390 AGATAAATTCACAAATGAAATGG - Intronic
957176022 3:76810716-76810738 ATGTAACATTACCCAAGAAATGG + Intronic
958132381 3:89444908-89444930 ATGGAAATTCTCTAATGAAAAGG + Intronic
958482111 3:94655549-94655571 ATTGATCTTCACCAAGGAAATGG - Intergenic
959331439 3:105010473-105010495 ATGTATTCTCACCTATGAAATGG - Intergenic
962802506 3:138902396-138902418 ATGTAACATCACCAATGGTGGGG - Intergenic
962948183 3:140192762-140192784 ATCTAAATACAACAATGAAAAGG - Intronic
964050816 3:152391087-152391109 CTGTTTCTTCACCAATAAAATGG - Intronic
965357163 3:167690316-167690338 ATGCAAATGCACTAATGAAAGGG + Intronic
966508814 3:180737193-180737215 ATGTACTTTCACCTGTGAAATGG - Intronic
966702566 3:182871457-182871479 ATATATCTTCACCAGTGAATTGG - Intronic
967337847 3:188364030-188364052 ATGTAACTTGCCCAAGCAAATGG - Intronic
967485627 3:190027127-190027149 AACTAACTTCACCAAACAAATGG + Intronic
969970809 4:11046315-11046337 AAGAAACTGCATCAATGAAAGGG - Intergenic
970291695 4:14579729-14579751 ATCCACCTTCACCAATGTAAGGG - Intergenic
970693896 4:18652981-18653003 ATATATTTTCACCAATGAGAGGG + Intergenic
971468907 4:26998052-26998074 AAGTATCTTCACCTATAAAATGG + Intronic
972009764 4:34162972-34162994 AATTAACTTAACCAAAGAAATGG + Intergenic
972098090 4:35374504-35374526 ATTTAGCTGCACCCATGAAAAGG + Intergenic
972736682 4:41848902-41848924 AAGTAATTTCCCCAATGAGAAGG - Intergenic
973083802 4:46029250-46029272 ATGCAACATCACCAATGATCAGG + Intergenic
973604368 4:52571846-52571868 ATGAAACTTCACAGATGAAGTGG - Intergenic
974413812 4:61578065-61578087 ATTTCACTTCACTAATGAAATGG + Intronic
976822980 4:89227869-89227891 AACTAACTTCCCTAATGAAACGG - Intergenic
977155829 4:93572098-93572120 ATCTAACTTGGCCTATGAAATGG + Intronic
977648718 4:99444375-99444397 ATGTAACTTGGACACTGAAATGG + Intergenic
977743259 4:100512979-100513001 ATGTAACTTCACCAATGAAAAGG + Intronic
978634651 4:110789891-110789913 CTGTAATTTAAACAATGAAATGG + Intergenic
979781931 4:124662720-124662742 ATGTAAGTGTACAAATGAAATGG + Intergenic
980816493 4:137953311-137953333 ATTTTACTTAACCAAAGAAAGGG + Intergenic
981134217 4:141191571-141191593 TTGTGACTTCAGCAATGAAGAGG + Intronic
982374610 4:154675730-154675752 ATGTAACTTCCCAAAGGAAGAGG - Intronic
982623421 4:157733503-157733525 ATGTAATTTCATCAGTGTAATGG + Intergenic
983533811 4:168836499-168836521 CTGAAATTTCACCAATGAATGGG + Intronic
987065046 5:14281546-14281568 ATATAACTGCAACAATTAAATGG - Intronic
988136829 5:27183696-27183718 ATGTATTTTCACGAAGGAAATGG - Intergenic
988216767 5:28285113-28285135 ATGTAGCAATACCAATGAAAGGG - Intergenic
989269791 5:39519247-39519269 TGGAAATTTCACCAATGAAAGGG + Intergenic
990206727 5:53437847-53437869 ATGTAAATCTACTAATGAAAAGG + Intergenic
991196418 5:63939324-63939346 ATGTTCCTTCACCAGTGAATGGG + Intergenic
992223372 5:74594501-74594523 ATATAATTTCAGAAATGAAATGG + Intergenic
992531552 5:77656974-77656996 AACTAACTTCTCCAATCAAAAGG - Intergenic
993118037 5:83741126-83741148 ATGTTATTTTACTAATGAAAAGG - Intergenic
994516438 5:100778114-100778136 AAGCAAATTCACCAAGGAAAAGG - Intergenic
996462964 5:123768581-123768603 AGGAAAATTCACCAAAGAAATGG - Intergenic
996908783 5:128632656-128632678 GTGTAATTTCATCAATGTAATGG + Intronic
998341813 5:141424391-141424413 ATGTAACTTCACCATAGTAATGG - Intronic
999778075 5:154826666-154826688 TGGTAAGTTCACCAATGATATGG - Intronic
1000856515 5:166404685-166404707 GTGAAACTTCACCAATCAGAGGG - Intergenic
1008085112 6:47236175-47236197 ATGTATTTTCTCAAATGAAAGGG - Intronic
1008245362 6:49164652-49164674 ATGCAAATTCACAGATGAAAAGG - Intergenic
1009482592 6:64178340-64178362 ATATAACTAAACCAAGGAAAGGG - Intronic
1010371931 6:75120434-75120456 AAGAAAATTCACCAAAGAAATGG + Intronic
1011759940 6:90552717-90552739 AAGTAACTTTACTAATGAAGAGG + Intronic
1012222824 6:96671087-96671109 ATGTAAATATACCAATTAAAAGG + Intergenic
1012516538 6:100068055-100068077 ATGTATTTTCACCCTTGAAATGG + Intergenic
1013896982 6:115101171-115101193 ATGTAAATGCCCCAATTAAAAGG - Intergenic
1016805681 6:148210059-148210081 ATGAAACATCAGCACTGAAAAGG + Intergenic
1017117220 6:150989213-150989235 AAGTAACTTTAGGAATGAAAGGG + Intronic
1017291295 6:152741676-152741698 GTGTAACTTCACAACAGAAAAGG - Intergenic
1017414026 6:154200859-154200881 AAGCAACATCACCAATGATATGG + Intronic
1017423899 6:154300894-154300916 CTGTTACTTGACCACTGAAAAGG + Intronic
1018814964 6:167323722-167323744 GTGTAACATCTCCAATGGAAGGG + Intergenic
1020369946 7:7421121-7421143 CTGTAAATTCAGCAATAAAAAGG + Intronic
1022801417 7:33780620-33780642 CTGGAACTTCAACAATGAATGGG - Intergenic
1023854474 7:44173897-44173919 CTGTTTCTTCACCTATGAAAAGG + Intronic
1026480489 7:70774894-70774916 ATGTAAAGTCATCAATGTAAGGG + Intronic
1029022482 7:97379417-97379439 ATGTGATTTCTCCAATAAAAGGG + Intergenic
1030114056 7:106049943-106049965 GTGTAACTCCAACAATGAAATGG - Intergenic
1030487452 7:110188240-110188262 AAGTAACTTCCCCAGTCAAATGG + Intergenic
1032456329 7:132075913-132075935 ATGTCCTTTCACCTATGAAAGGG + Intergenic
1032791205 7:135243903-135243925 ATTAAACTTCAGCAACGAAAAGG + Intronic
1036219682 8:6910925-6910947 GTGTAAGTTCCCAAATGAAAAGG + Intergenic
1036397655 8:8382714-8382736 TTGTAAATTCACCACTGAGAAGG + Intronic
1037851761 8:22336095-22336117 ATGTAAGATCAACAAGGAAATGG + Intronic
1037958925 8:23081683-23081705 ATGTGACTTCTCTCATGAAAAGG - Intergenic
1038934493 8:32233436-32233458 ATGTACTTTCACATATGAAAAGG + Intronic
1039423651 8:37467169-37467191 ATGGAACTTTGACAATGAAATGG + Intergenic
1039975347 8:42359247-42359269 ATGTAACTTTATGAAAGAAAGGG - Intronic
1039992698 8:42503211-42503233 AAGTAGTTTCACTAATGAAAAGG - Intronic
1040597200 8:48850347-48850369 ATTTAACTCAACCAATAAAAAGG - Intergenic
1042834463 8:73066193-73066215 AATTTACTTCACAAATGAAAGGG + Exonic
1045133528 8:99186554-99186576 ATGTAACAATACCAATGAAGAGG - Intronic
1046789298 8:118304101-118304123 AGGTAGCTTCACCAAAGAATAGG - Intronic
1048925043 8:139264137-139264159 ATGTAACTTCCTCAAAAAAATGG + Intergenic
1050200992 9:3145964-3145986 AAGAAACTGCACCAATGAATGGG - Intergenic
1050632002 9:7569509-7569531 CTGTGACTTGACCATTGAAAAGG - Intergenic
1050723205 9:8614873-8614895 AAGTAACTCCACCAAGGAAGAGG + Intronic
1055543463 9:77340829-77340851 ATGTAAATGCACCAAAGAGAAGG + Intronic
1055615991 9:78073593-78073615 ATGTAGCTTAACTAATGTAAAGG - Intergenic
1058024215 9:100122910-100122932 ATGTAAATACATCAATAAAAAGG - Intronic
1058832947 9:108835668-108835690 CTCTGACTTCACAAATGAAAAGG - Intergenic
1059509777 9:114834275-114834297 AGGAAAATTTACCAATGAAATGG - Intergenic
1186099562 X:6141164-6141186 CTGTGACTGCACCAAGGAAAGGG + Intronic
1188830628 X:34892495-34892517 ATGTAACTTGATCACTGAACTGG + Intergenic
1189967898 X:46392979-46393001 ATGTGACTAGACCAAGGAAAAGG + Intergenic
1191091537 X:56628281-56628303 ATGTAAATTTCCCAATTAAAAGG + Intergenic
1192483337 X:71503827-71503849 ATATAATTTCACCCATTAAAAGG + Intronic
1195963143 X:110405956-110405978 CTGTAATTACAGCAATGAAAAGG + Intronic
1197612337 X:128653427-128653449 TTTTAACTTCACCAACAAAATGG - Intergenic
1198590923 X:138180487-138180509 AAGCAACTTCACCAATGCAATGG + Intergenic