ID: 977745575

View in Genome Browser
Species Human (GRCh38)
Location 4:100542759-100542781
Sequence TCCTCACCTTTCTTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977745575 Original CRISPR TCCTCACCTTTCTTTCTGCC TGG Intronic
900126945 1:1072903-1072925 TCCTCACCATTATTTCTGCCCGG - Intronic
900379046 1:2374556-2374578 GCCTCACCCTTCTCTCTGCAGGG - Exonic
900593108 1:3468545-3468567 TCCGCACCTCTCCATCTGCCGGG + Intronic
900878994 1:5367013-5367035 GCCTCACCCTTCCTTCTGCAGGG - Intergenic
901273305 1:7970601-7970623 CCCTCCCATTTCTTTCTCCCTGG + Intronic
902171941 1:14618841-14618863 CCCTCACCTTTCCTTCAGCCTGG - Intronic
902224386 1:14987583-14987605 TCCTCAGCCTTCTCCCTGCCTGG - Intronic
903051139 1:20602113-20602135 CCCTCTCCTTTCTTTTTGACAGG - Intronic
903541876 1:24101035-24101057 TCCTTGCCTCTCTTTCTGCTCGG + Intronic
903768210 1:25748196-25748218 ACCCCACCTTGCTTTCTTCCAGG - Intronic
903873091 1:26451369-26451391 TCCTCATTTTTCTTTCTTCCAGG + Intronic
904794367 1:33047988-33048010 TCCTCACCTTTGACTCCGCCAGG - Intronic
905396255 1:37668622-37668644 TCCTCTCCCTTCTCCCTGCCTGG - Intergenic
905675030 1:39818980-39819002 TCCTGACTTTTCATTCTCCCAGG + Intergenic
906949442 1:50322597-50322619 TCCTCACCTGTCCTTCTCCAGGG + Intergenic
907284621 1:53371663-53371685 TCCTCCCCTGCCCTTCTGCCTGG + Intergenic
909251663 1:73364981-73365003 TCCTCTTCTTTCTCTCTTCCTGG - Intergenic
910081581 1:83348211-83348233 TCTTCATCCTCCTTTCTGCCTGG - Intergenic
910719266 1:90267622-90267644 TCCTCACCCCTCATTCTGCTGGG - Intergenic
911341629 1:96645708-96645730 TCTTCTGCTTTCTTTCTGCCTGG - Intergenic
912327168 1:108777669-108777691 TCCTTTCCACTCTTTCTGCCTGG + Intronic
914714086 1:150239811-150239833 TCCCCAGCTTCCTCTCTGCCAGG + Intergenic
915312589 1:155011828-155011850 GCCTCCCCCTTCTTTCTGCCAGG - Intronic
915932841 1:160070466-160070488 TCTTCATCTCTCTTTCTCCCCGG - Intergenic
916393894 1:164364345-164364367 TCCTCTCCTCTCTTTCTGGTAGG - Intergenic
916518657 1:165543884-165543906 TCCTCACCTCTCCTTCTGGGTGG - Intergenic
917058893 1:171015531-171015553 TCCTTGCCTTTCTTTCTCTCTGG + Intronic
917302836 1:173595347-173595369 GCTTTACCTCTCTTTCTGCCTGG - Intronic
918294861 1:183146980-183147002 TCCTCACCTTCCTGGGTGCCTGG - Intergenic
918331377 1:183464156-183464178 TCCTTTCCTTTCTTTTTGACAGG - Intergenic
918929940 1:190842202-190842224 TCTTCTCCTTTCTGGCTGCCTGG - Intergenic
920225402 1:204434862-204434884 TCTTCTCCTTTCTTTCTCCTAGG + Intronic
920347580 1:205316581-205316603 TTCAAACCTTTCTTTCTGTCTGG - Intronic
920437045 1:205953782-205953804 TCATTGCTTTTCTTTCTGCCTGG - Intergenic
920496354 1:206457647-206457669 TCCTCATCTTTCTGCCTGCAGGG - Intronic
920540171 1:206772233-206772255 TCCTGTCCTTTCTCTCTTCCTGG - Intronic
920760856 1:208782532-208782554 ACCTCATCTTTCTTTCTCACAGG - Intergenic
921436616 1:215130505-215130527 TGCTCACATTTCTTTCTGCCTGG - Intronic
922330151 1:224567760-224567782 CCCTCACCTTGATTTCTACCTGG - Intronic
1063609941 10:7553611-7553633 TCCCCTCCTTTCTTTCTCGCTGG + Intergenic
1067044738 10:42979099-42979121 TCCTCTCCTTCCTCTCTTCCAGG - Intergenic
1067348659 10:45456303-45456325 GCCTCTCCTTTCTGTCTCCCAGG - Exonic
1067534570 10:47099547-47099569 TCCTCCCCTTTCCTCCTTCCTGG + Intergenic
1068968330 10:62936085-62936107 CCCTTCCCTTTCTTCCTGCCTGG - Intergenic
1071422616 10:85515780-85515802 TCCTCACCTTACCCTTTGCCTGG - Intergenic
1073434422 10:103507662-103507684 TGCTCACCTGTCTCTCTTCCTGG - Intronic
1074363298 10:112839414-112839436 TCCTGGCCTTTCCCTCTGCCTGG - Intergenic
1074516689 10:114176766-114176788 TCCTTTCCTTTCTTTCTGAAAGG - Intergenic
1074890315 10:117730331-117730353 TCCTCTCCTTTCTCCCTGACAGG - Intergenic
1074894326 10:117761984-117762006 TCCTTAGCTTCCTTTCTGCCTGG + Intergenic
1075434653 10:122426670-122426692 TCCTCTCCTTGTTTTCTGTCTGG + Intronic
1075615369 10:123886981-123887003 TCCTCAGTTTTCATTCTCCCAGG - Intronic
1077431375 11:2517502-2517524 GCCTCACCTCTCTGTCTGGCAGG + Intronic
1079759173 11:24307568-24307590 TCTTCAACTTTCTTATTGCCAGG - Intergenic
1080232882 11:30037541-30037563 TCCTTACTGTTCCTTCTGCCTGG + Intergenic
1080375761 11:31708677-31708699 TGCTCAACTTTCTTACTGCTGGG - Intronic
1080836124 11:35942917-35942939 CCTTCCCCTTTCTTTCAGCCAGG + Intergenic
1082569640 11:54722386-54722408 TCCACACCTTACTTCCTGCAAGG - Intergenic
1082945265 11:58751366-58751388 ACCTGACCTTTCTCTCTGGCTGG - Intergenic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1084552282 11:69851938-69851960 ACCCCGCCTTCCTTTCTGCCTGG + Intergenic
1084720931 11:70905154-70905176 TCCTCACCTGCCTGTCTGGCTGG - Intronic
1084785835 11:71441154-71441176 CCCTGGCCTTTCTTGCTGCCTGG - Intronic
1085316957 11:75551059-75551081 TCCTCTCCTTGCCTTCTTCCAGG + Intergenic
1085885948 11:80521981-80522003 TCCTCCCATTTCCCTCTGCCTGG + Intergenic
1087163291 11:94972923-94972945 TCCTCAAGTTACTTTCTGCTTGG + Intronic
1088088653 11:106011411-106011433 TCCACACTGTTCCTTCTGCCTGG + Intronic
1089042335 11:115463905-115463927 TCCTCAGCTTTCCAGCTGCCAGG + Intronic
1089330194 11:117684022-117684044 ACCTTGCCTTTCTTTCTCCCTGG + Intronic
1090951717 11:131479448-131479470 TTCTCACCATTCCTTCTTCCGGG - Intronic
1091044504 11:132313707-132313729 TCCTTACCCTTTTATCTGCCTGG + Intronic
1091397347 12:162097-162119 TCCTTTCCTTTCTTTCTTCCTGG + Intronic
1092921207 12:13233183-13233205 TCTTTCCCTTTCTTTCTGACAGG + Intergenic
1093716766 12:22391702-22391724 TTCTCCCTTTTCTTTCTCCCTGG - Intronic
1094639434 12:32259604-32259626 ATCTCTCCTTTCTCTCTGCCTGG - Intronic
1095721787 12:45408808-45408830 TCATCACCGTTCCCTCTGCCTGG + Intronic
1096634364 12:52949146-52949168 TCCTGTCCTTTCTCTCTCCCCGG + Exonic
1096769249 12:53923643-53923665 TTCTCACCTTTCTTTCTGCCTGG + Intergenic
1096971486 12:55669968-55669990 ACCTCCCTTTTCTTTCTGTCAGG - Intergenic
1097643491 12:62208971-62208993 TAATCCTCTTTCTTTCTGCCTGG + Intronic
1100146187 12:91680459-91680481 TACTCAATTTTCCTTCTGCCTGG - Intergenic
1100993147 12:100271990-100272012 TACTCATCCTACTTTCTGCCAGG + Intronic
1101241464 12:102843639-102843661 ACCTCACCTTACTTTCTCCTTGG + Exonic
1101706845 12:107228464-107228486 TCCTCCTCTTTCTTCCTGCCTGG - Intergenic
1101708386 12:107242216-107242238 TCCTCATCTTTCTTTCTATAAGG - Intergenic
1102536139 12:113582909-113582931 TCCTCACCTTTCCTTCTCCAGGG - Intergenic
1102967077 12:117136190-117136212 TACCCACCTTTCTTGGTGCCAGG - Intergenic
1103012645 12:117469122-117469144 TCCTCCCCCTTGTTTCTGGCTGG - Intronic
1103454298 12:121052891-121052913 GCCTCACCTTTCTGTGTGGCTGG - Intergenic
1103783011 12:123412083-123412105 TCTTAACCTTTCTTTCTGAGTGG + Exonic
1103909699 12:124345433-124345455 TCCTCACCATCCTTTCTGTCTGG - Intronic
1105213412 13:18271123-18271145 TCCACACCCCTCTTTCTGCAGGG + Intergenic
1105427733 13:20309336-20309358 TCCCCTCCTTTAATTCTGCCAGG - Intergenic
1106290632 13:28357965-28357987 GCCTCACATTTCTTTCTACAGGG - Intronic
1107044280 13:35978769-35978791 TCCACACCTTTTTTTCTGTAAGG + Intronic
1107730080 13:43339765-43339787 ACCTCAGCTTTCCTTCTCCCAGG - Intronic
1109083583 13:57940883-57940905 TCCTGAGCTTTCTTTCTAGCTGG + Intergenic
1110456400 13:75694780-75694802 TCCTCACATTTCCTGCTCCCAGG - Intronic
1111653525 13:91123961-91123983 TCATCAACTTTCTTTCTGTTTGG + Intergenic
1111934196 13:94542612-94542634 TCCCCACCTTTCCATTTGCCTGG + Intergenic
1112220325 13:97482915-97482937 TCCGCCCCTTTCTTCCTTCCAGG + Intergenic
1112610655 13:100951774-100951796 TTCCAAGCTTTCTTTCTGCCTGG + Intergenic
1114196996 14:20487189-20487211 TCCTCACCTCTCATTCTTTCTGG - Intergenic
1114796947 14:25726858-25726880 TCCTCCACTTTGTTTCTGCAAGG + Intergenic
1115028862 14:28771378-28771400 TCATCACCTTTTTTTCAGCTTGG - Intergenic
1116864109 14:50017474-50017496 TCCCCTCATTTCTTTCTGCAAGG + Intergenic
1117000165 14:51364030-51364052 TCCTCACCACACTTGCTGCCAGG - Intergenic
1118841644 14:69517740-69517762 TACCTACCTTTCCTTCTGCCTGG + Intronic
1119023610 14:71135664-71135686 TCCTCACCCTCCATTCTCCCTGG + Intergenic
1119236763 14:73026660-73026682 TCCTCACCCTTCCTTCCACCCGG + Intronic
1120092200 14:80345003-80345025 TCCTCATTTTTATTTCTTCCTGG - Intronic
1120982685 14:90304545-90304567 TAATTAACTTTCTTTCTGCCTGG + Intronic
1122292933 14:100689137-100689159 TCTAGACCTTTCCTTCTGCCAGG + Intergenic
1122853771 14:104550153-104550175 TCCTGACCCTTCTTCCTGCCTGG + Intronic
1125231636 15:37463353-37463375 TCCTCCCTTTGCCTTCTGCCAGG - Intergenic
1125235690 15:37511110-37511132 TCCTCACATTTATTTTTGCATGG + Intergenic
1126303313 15:47224878-47224900 CCCTCTCCTTTCTTGCTGCTCGG + Intronic
1127809210 15:62548801-62548823 TCCTACCATTCCTTTCTGCCTGG - Intronic
1129304631 15:74650418-74650440 TCTTCCTCTTTCTCTCTGCCTGG + Intronic
1131806202 15:96125294-96125316 TTCTCTCCTTTCTGGCTGCCTGG - Intergenic
1131954808 15:97722558-97722580 TCATCACTTTTCTTTATGCCTGG - Intergenic
1133611662 16:7439385-7439407 GCCTCACCTTTCTTTCTGGGTGG + Intronic
1134611638 16:15613875-15613897 TCCTCACCTTTTTTCCTGTAGGG + Intronic
1135901326 16:26462583-26462605 TGTTCACCTTTCTTTCTCCGGGG - Intergenic
1136650615 16:31666716-31666738 TCCTCTCTTTTCTTTCTAACAGG + Intergenic
1137490374 16:48927438-48927460 CCCTCAGCTTCTTTTCTGCCAGG - Intergenic
1138314650 16:56059446-56059468 TCCTCATCCTTCTTCCTCCCAGG - Intergenic
1138478109 16:57283997-57284019 TTTTCACCCCTCTTTCTGCCCGG - Intronic
1139589576 16:67926090-67926112 CCCTCACTTTCCTTCCTGCCAGG - Intronic
1140337191 16:74118700-74118722 TCCTCTCCTCTCTTTCTTCCTGG - Intergenic
1140657240 16:77153288-77153310 GCCACACATTTCCTTCTGCCTGG - Intergenic
1140801445 16:78491952-78491974 TCTTCACCTGACTTTCTCCCTGG + Intronic
1141108698 16:81254511-81254533 GCCTCACCTTTTTATGTGCCAGG + Intronic
1141326383 16:83063471-83063493 TCCTAACCATTCTCTCTGCGGGG - Intronic
1141501352 16:84446451-84446473 ACCTCTTCTCTCTTTCTGCCCGG + Intronic
1141615363 16:85206867-85206889 TCCTGCCCTTTCTTTATGGCAGG + Intergenic
1141841033 16:86574257-86574279 CACTCACCTTTAATTCTGCCAGG + Intergenic
1141884483 16:86882419-86882441 TCCTGCCCTTTCTTTCTGCAGGG - Intergenic
1142576827 17:914641-914663 TCCTCATCTTTGTCTCCGCCTGG - Intronic
1143028757 17:3955717-3955739 CCCTCACCTTTCTTTATTCTGGG + Intronic
1143131798 17:4683079-4683101 TCCACACCCTCTTTTCTGCCAGG - Intronic
1143574123 17:7779937-7779959 TCCTTTCCTTACTTTCTGCATGG - Intronic
1145945344 17:28769840-28769862 TCCTTACCATTCCCTCTGCCTGG + Intronic
1146560049 17:33860247-33860269 TCTTCCCCTTCCTTTCTACCTGG - Intronic
1146889178 17:36494172-36494194 CCCACACCATTCCTTCTGCCTGG + Intronic
1148154613 17:45415794-45415816 CCCTACCCTTTCTTTCTGCCTGG - Intronic
1148976998 17:51538386-51538408 TCCTCACATCTCTATCTGGCAGG - Intergenic
1149513387 17:57260798-57260820 TCCTCATATGTCTTTCTGGCTGG + Intronic
1150196698 17:63306130-63306152 TACTCTCCTTGCTTCCTGCCTGG - Intronic
1150797360 17:68248622-68248644 TCCACAACTTTCTTCCAGCCAGG + Exonic
1150864429 17:68834732-68834754 TTCTTTCCTTTCTTTCTACCTGG + Intergenic
1151655435 17:75493691-75493713 TCCAGCACTTTCTTTCTGCCAGG - Exonic
1152719403 17:81915516-81915538 ACCTTGCCTTCCTTTCTGCCTGG - Intronic
1153121129 18:1729050-1729072 TCCTCACTGTTCCTTCTGCCTGG - Intergenic
1154095831 18:11414072-11414094 TGCTCACCTCTCTCTCTTCCTGG + Intergenic
1154148646 18:11887887-11887909 TGCTCACCTTTCCCTCTGCCAGG - Intronic
1154966644 18:21364440-21364462 TCTTCTCCTTTCTTACTCCCTGG - Intronic
1156119545 18:33825366-33825388 TCCTCCTCTTTCTTTGTGCCTGG - Intergenic
1156256567 18:35403451-35403473 TCCTTGCCTTTGTCTCTGCCAGG - Intergenic
1156284357 18:35676364-35676386 CCTTGTCCTTTCTTTCTGCCAGG - Intronic
1156785879 18:40914609-40914631 TCATATCCATTCTTTCTGCCTGG + Intergenic
1157171226 18:45407749-45407771 TCCTCACCTCTCTCTCTCCTTGG - Intronic
1157176826 18:45459556-45459578 TGCTCACCTTCCTTTCTTCTTGG - Intronic
1157236158 18:45967170-45967192 TCCTCACCTTTGTTTTAGTCCGG + Exonic
1157424280 18:47571618-47571640 GCCTGACCTTTCTTTCTAACAGG + Intergenic
1158220503 18:55145966-55145988 TCCTCACCTTTCCTCTTGGCTGG + Intergenic
1159243487 18:65774723-65774745 TCCAGACCTCTCTTTCTCCCAGG - Intronic
1159317989 18:66804722-66804744 TCATCACCCTACATTCTGCCAGG - Intergenic
1160135091 18:76264868-76264890 TCCTCACCTTTGTTTCTCCTGGG - Intergenic
1161202760 19:3025082-3025104 TCCTCTCATTGCTTCCTGCCAGG - Exonic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161738786 19:6007689-6007711 GCCCCACCTCTCTTCCTGCCAGG - Exonic
1162630710 19:11925106-11925128 TCCTCACCTTCCTCGCTGCGCGG + Exonic
1164747988 19:30629971-30629993 TCCACTCCCTTGTTTCTGCCAGG + Intronic
1165358531 19:35319143-35319165 TTCTCACCTTCCTTCCTGCCTGG - Intergenic
1166276668 19:41758690-41758712 TCCTCCCCTTTCATTCTAGCTGG + Intronic
1166561600 19:43736366-43736388 TCCTGTCCCTTCCTTCTGCCTGG + Intronic
1167128588 19:47569207-47569229 CCCTCACTTATCTTCCTGCCTGG + Intergenic
1167539112 19:50074188-50074210 TCCCTTCCTCTCTTTCTGCCTGG - Intergenic
1168502678 19:56906555-56906577 CTTTCCCCTTTCTTTCTGCCTGG - Intergenic
926231001 2:11003786-11003808 TGCTCCCCTTTCTACCTGCCTGG + Intergenic
926619051 2:15030556-15030578 TGGGCACCTCTCTTTCTGCCAGG + Intergenic
926769797 2:16360137-16360159 TCCTCTGCTTTCTCACTGCCAGG - Intergenic
926889679 2:17628556-17628578 TCCTCACAAATCTTTCTCCCTGG - Intronic
927314802 2:21669379-21669401 TACTCTCCTTTCTTTTTCCCTGG + Intergenic
927699012 2:25256162-25256184 TCCTGACCTCTCTTTTTGTCTGG - Intronic
927730364 2:25465657-25465679 TCCTCCCCATTCCCTCTGCCTGG + Intronic
928065830 2:28163659-28163681 CCCTTACCTTTCTTTCTGGCTGG - Intronic
929024036 2:37581926-37581948 TCATCCCCTTTCTTCCTTCCAGG - Intergenic
929167405 2:38896886-38896908 TCCATATCTTTCTTTTTGCCCGG + Intronic
929659671 2:43771196-43771218 TCCTCACCTTTCTTATGGCTTGG - Intergenic
930948197 2:57102565-57102587 TCCTCAGCTTTTTTTCAGCTGGG + Intergenic
931485607 2:62688021-62688043 TCCTCAGCTTTCTTTCTCACTGG + Intronic
931984504 2:67728619-67728641 CCCTCTCCTTGCTTCCTGCCTGG + Intergenic
933993193 2:87648481-87648503 TCCTCACCCTTCTTCCTAACTGG + Intergenic
934300911 2:91775621-91775643 TCCACACCCCTCTTTCTGCAGGG - Intergenic
934813609 2:97305395-97305417 ACCTCACCTTTCTTTCTCTCTGG + Intergenic
934824086 2:97403085-97403107 ACCTCACCTTTCTTTCTCTCTGG - Intergenic
935201839 2:100863425-100863447 TGCACATCTTTCTATCTGCCAGG - Intronic
936300664 2:111302402-111302424 TCCTCACCCTTCTTCCTAACTGG - Intergenic
936922056 2:117698900-117698922 TCCTCTCCTTTCTCTCTTACAGG + Intergenic
937070701 2:119060988-119061010 GCCCCAGCTTTCTGTCTGCCTGG + Intergenic
937132810 2:119525659-119525681 TCCTCCCTTTTATTTCTGCTGGG - Intergenic
937753944 2:125513612-125513634 GACACACCTTTCTTTCTGCTAGG - Intergenic
938070405 2:128305443-128305465 TGCTCACCTTCCTGCCTGCCAGG + Intronic
938949527 2:136244017-136244039 TGCTCCCCTTTCTCTCTGCAGGG - Intergenic
939991687 2:148881957-148881979 GTCTCACCTTACTTTCTTCCAGG + Intronic
941802935 2:169681063-169681085 TCTTTGCCTTTCTTTCTGCACGG + Exonic
941995240 2:171595736-171595758 TCTTCTCCTTCCTTTCTCCCTGG - Intergenic
943432806 2:187825517-187825539 TCCTCCACTTTCTTACTACCAGG - Intergenic
944147235 2:196518850-196518872 TCCTCACCAGTCTTTCTGCCAGG + Intronic
944854071 2:203749651-203749673 TCCTCACCTTTCTGTCCTCTAGG - Intergenic
948027595 2:234790329-234790351 TCCTCTCATTTCTTTCTCCTTGG - Intergenic
1169083823 20:2815086-2815108 AGCTCACCCTTCTGTCTGCCCGG + Exonic
1169228611 20:3871897-3871919 TCCATACCTTACTGTCTGCCAGG + Exonic
1171071051 20:22068984-22069006 TCCTCAACCCTCTTTCTTCCTGG - Intergenic
1172291191 20:33778253-33778275 ACCTTCCCTTTCTTGCTGCCTGG + Intronic
1172327012 20:34044042-34044064 TCCTCACTGGTCTTTCTGCTTGG - Intronic
1173494570 20:43509228-43509250 CCCTCCCCTTTCTCTCTGACAGG + Intronic
1173667715 20:44774716-44774738 TCCTGACCTTTCACCCTGCCTGG + Intronic
1174151258 20:48488266-48488288 ACATCAGCTTTCTTTGTGCCTGG + Intergenic
1174280234 20:49433934-49433956 TCCTCTCCTCTCCTCCTGCCAGG + Intronic
1174584044 20:51593589-51593611 TCCCCACCTTTATTCCTACCTGG + Intergenic
1175124278 20:56739848-56739870 CTCTTGCCTTTCTTTCTGCCTGG - Intergenic
1175173247 20:57094134-57094156 TCCCCCCCTTTGTTCCTGCCTGG + Intergenic
1175778442 20:61667345-61667367 TCCTCACCATTCTGTGAGCCAGG + Intronic
1177029121 21:15960564-15960586 TCCTCTTCTTTCTTTCTGATAGG - Intergenic
1178714692 21:34953418-34953440 TCCTTCCCTTTCCTTCTGACTGG + Intronic
1180816244 22:18791523-18791545 TCCACACCCCTCTTTCTGCAGGG + Intergenic
1181202433 22:21225855-21225877 TCCACACCCCTCTTTCTGCAGGG + Intronic
1181699273 22:24610759-24610781 TCCACACCCCTCTTTCTGCAGGG - Intronic
1181871301 22:25901388-25901410 TCCTCACCTGTGATACTGCCAGG + Intronic
1181992643 22:26849242-26849264 TCATCTCCCATCTTTCTGCCTGG - Intergenic
1182085326 22:27557255-27557277 TACTCACCTCTCTTCGTGCCTGG - Intergenic
1183218455 22:36496439-36496461 TCCTGACTGTTCTCTCTGCCTGG - Intronic
1183538974 22:38418773-38418795 TGCCCACCTTCCTCTCTGCCTGG + Intergenic
1203224480 22_KI270731v1_random:69558-69580 TCCACACCCCTCTTTCTGCAGGG - Intergenic
1203266347 22_KI270734v1_random:17234-17256 TCCACACCCCTCTTTCTGCAGGG + Intergenic
949192612 3:1268099-1268121 TTCTCACCTTTTGTTCTGCAGGG - Intronic
949694341 3:6677018-6677040 TCCTCCCCTTTCTGTCTTCCTGG + Intergenic
951336441 3:21428400-21428422 AAATCTCCTTTCTTTCTGCCAGG - Intronic
952497216 3:33926261-33926283 TCCTTCCCTCTCTCTCTGCCAGG - Intergenic
952529237 3:34246204-34246226 TCCTCACCCTTATCTGTGCCAGG + Intergenic
953260003 3:41328739-41328761 GCCTCACCCTTACTTCTGCCTGG - Intronic
954149016 3:48648000-48648022 GCCTCCCCTTTCTTTCTCCTGGG - Intronic
954278724 3:49560464-49560486 TCCTGACTTTACTTACTGCCTGG + Intronic
954364720 3:50139721-50139743 TCCTCACCAGCCTTTCTCCCAGG - Intergenic
954863690 3:53711419-53711441 TGCTCACCTAACTGTCTGCCTGG - Intronic
954949056 3:54452995-54453017 TTCTCCTCTTTCTTTCTGACAGG + Intronic
955522272 3:59786354-59786376 CCCTCCTCTTTCTTTCTACCTGG + Intronic
955580278 3:60412418-60412440 TCATCTCCCTTCTGTCTGCCAGG + Intronic
955876264 3:63493056-63493078 TCCTAACATTTCTTTCTTTCAGG - Intronic
956106286 3:65822150-65822172 TCCTCATCTCTCTTTCTTCCTGG - Intronic
956571723 3:70703948-70703970 TCCTCATCTTTCTACGTGCCAGG + Intergenic
956750628 3:72341385-72341407 TCATCACTGTTGTTTCTGCCTGG - Intergenic
957632775 3:82739280-82739302 TCCTCATTTCTTTTTCTGCCAGG + Intergenic
959870779 3:111325147-111325169 TCCTTACCTATCATTCTACCTGG - Intronic
959875854 3:111380976-111380998 ACCTGACCTTTCTCTCTGGCTGG - Intronic
959944624 3:112113802-112113824 TTCTGACCTTCCTTTCTGTCAGG - Intronic
961127787 3:124436465-124436487 ATCACACCTTTCTTTCTGCAAGG - Intronic
962204388 3:133423102-133423124 TTCTCTTCTTTCTTTGTGCCTGG - Intronic
964775876 3:160276466-160276488 TCATGATCTTTGTTTCTGCCTGG - Intronic
965835649 3:172849061-172849083 TCCCCACTTTTCTTTCTCCAAGG + Intergenic
965930045 3:174031101-174031123 TTCTCACCTGTCTTTCTGAAGGG - Intronic
967053779 3:185809624-185809646 TTCTTTCCTTTCTTTCTGACAGG - Intronic
967454962 3:189674426-189674448 TGCTCCCCTTTCTTGCTTCCTGG - Intronic
969073784 4:4561047-4561069 TCCTCACCCTTCTATGTGTCCGG - Intergenic
969105304 4:4802977-4802999 TCCTCCCCTTTCCTTCTTCTAGG - Intergenic
971015950 4:22488860-22488882 TCTTCTCCTTTTTTTCTCCCAGG - Intronic
971777726 4:30988984-30989006 TCCTCACCTTCCTTTTTAACAGG + Intronic
972062961 4:34903374-34903396 TCTTCATCTTTCTTTCTCTCAGG + Intergenic
972292215 4:37699683-37699705 TCCTCTCTTCTCTTTCTCCCAGG + Intergenic
973716115 4:53678183-53678205 TCCTTCCCTTGCTTTCTGACTGG + Intronic
973783426 4:54312733-54312755 TCTTCCCATTTCTTTCTGCCTGG + Intergenic
975468317 4:74734843-74734865 TCATCCCCTTTCTTCCTTCCAGG + Intergenic
975920907 4:79386053-79386075 ACCTCACCTTTCTTTCTGAATGG + Intergenic
976014850 4:80539809-80539831 TCCTAGCCTGTCTTGCTGCCAGG + Intronic
976208350 4:82642873-82642895 TCCCATCCTTTCTTTCTGGCTGG + Intronic
977745575 4:100542759-100542781 TCCTCACCTTTCTTTCTGCCTGG + Intronic
978119969 4:105066795-105066817 TCCACATCTATCTTTCAGCCAGG - Intergenic
978337364 4:107684186-107684208 TCCTCAGCTTTCTATTTGCAAGG - Intronic
979354937 4:119691907-119691929 TCCTCCCAGATCTTTCTGCCTGG - Intergenic
979444381 4:120793527-120793549 TCCCCAGCTTTCTTGATGCCAGG - Intronic
979719484 4:123882281-123882303 TCCTCACATTTCTCTCTGACTGG - Intergenic
979720708 4:123896838-123896860 TCTTCCCCTCTTTTTCTGCCAGG - Intergenic
981054845 4:140350097-140350119 TACCCACCTTTCTTTTTGTCTGG + Intronic
981908477 4:149951225-149951247 CCTTCACTTTTCTTTGTGCCTGG - Intergenic
982114137 4:152083117-152083139 TCCTCTCCTTTCTTTCTAGAAGG - Intergenic
982126150 4:152185581-152185603 TCCTGATCTTTCATTCTGCATGG + Intergenic
982984205 4:162184739-162184761 CACTCACCATTCTTTCTGCATGG - Intergenic
983601357 4:169532911-169532933 TCCTTTCCTTTCTTTCTACAGGG - Intronic
985016277 4:185638840-185638862 TCCTTACCTTTCTTCATGCCCGG - Intronic
985913716 5:2902167-2902189 TCCTCACCCTTCTCTCTCTCAGG - Intergenic
986292807 5:6413394-6413416 TCCTCTCCTTTCTGTCTGTCGGG + Intergenic
986439044 5:7762484-7762506 TCCTAACCTGCCTGTCTGCCTGG - Intronic
987794797 5:22613212-22613234 TCATCACATTTCAATCTGCCAGG - Intronic
988392284 5:30650317-30650339 TTCTCACTTTCCTTTCTGCCTGG - Intergenic
988392955 5:30659162-30659184 TCCTTATCTTTCTTTTTGCATGG + Intergenic
988516227 5:31907134-31907156 TCCTTACCTGTCTTTGTGCAGGG + Intronic
990360984 5:55019860-55019882 TCCTCACCTTCCTCTGTGCAAGG + Intronic
990537575 5:56737879-56737901 TCATCACCTTTAGTTTTGCCAGG - Intergenic
990598293 5:57332670-57332692 TCCACCACTTTCTTTCTGCCAGG - Intergenic
990650726 5:57896629-57896651 TCCTTACCTTTCTTTCAGTTGGG - Intergenic
990996807 5:61740662-61740684 TCCTCATCTTTTTGTCTTCCTGG + Intronic
990999385 5:61767560-61767582 TCATCACCTGCCTTTCTGCTGGG - Intergenic
991022672 5:61996668-61996690 TCCTAAGTTTTCTTGCTGCCTGG + Intergenic
991389799 5:66130200-66130222 TCCTCACTTTGGTTTCGGCCTGG - Intergenic
992076814 5:73199397-73199419 TCCTCATCTTTCCTGCTTCCTGG - Intergenic
992992223 5:82295529-82295551 TACTCACCTTACATTCTTCCTGG - Exonic
993735927 5:91476952-91476974 TCCACACCTTGGTTTCTGTCTGG - Intergenic
994571294 5:101517269-101517291 TCCAACCCTTTCTTTCTGCTAGG - Intergenic
994683791 5:102923818-102923840 TCCAGATCTGTCTTTCTGCCTGG + Intronic
995755056 5:115494385-115494407 TCCTCCCCTTTCCTTCTGGGAGG - Intergenic
996353491 5:122571868-122571890 TCCTCTCCTTTTGTTCTACCTGG - Intergenic
996465960 5:123803040-123803062 TCCTCACCTTCCCTTCTCCTTGG + Intergenic
996853561 5:127979459-127979481 TCCTCGGGTTTATTTCTGCCTGG + Intergenic
997616309 5:135248620-135248642 TATTCACCTTTTTTTTTGCCTGG - Intronic
998054239 5:139060905-139060927 TTCTTACCTGTCCTTCTGCCAGG - Intronic
998140783 5:139698206-139698228 TCCCCACCCTTCTGCCTGCCTGG + Intergenic
1002914371 6:1517238-1517260 TCCCCATCTTTCATTCTGCACGG - Intergenic
1002964320 6:1947493-1947515 AACCCACCTTTCTTGCTGCCAGG + Intronic
1004277715 6:14253259-14253281 TCCTCACCCAGCTCTCTGCCAGG + Intergenic
1004348415 6:14869384-14869406 TCTTTCTCTTTCTTTCTGCCTGG - Intergenic
1005060174 6:21769450-21769472 TCCTCATATTTCATTCTTCCAGG + Intergenic
1005788404 6:29270943-29270965 GCCACCCCTTTCTTTCTTCCAGG - Intergenic
1006116642 6:31779296-31779318 GCCTCACCTTTCTCCCTCCCTGG - Intronic
1006361552 6:33589883-33589905 TTCCTTCCTTTCTTTCTGCCTGG + Intergenic
1007159523 6:39777779-39777801 TCCTCACCTCTCTTGCACCCAGG + Intergenic
1007431920 6:41781396-41781418 CCCCCTCCTTTCTTGCTGCCTGG + Exonic
1007533720 6:42565466-42565488 TCCTGACATTTCTTTCTACCCGG - Intronic
1007670557 6:43549545-43549567 TCCTCACATTCCTCACTGCCCGG + Exonic
1007777818 6:44233573-44233595 TCCTGCCCCTTCCTTCTGCCAGG + Exonic
1007828652 6:44621187-44621209 TCTTCTACTTTCTTTCTTCCAGG + Intergenic
1008321943 6:50125193-50125215 TCCTCATCTTTTTGTCTTCCTGG + Intergenic
1008368782 6:50711204-50711226 TCCTCAACTTTGTTTCTTTCAGG + Intergenic
1008870122 6:56262871-56262893 TCCTCACCTTGCTTTCTAGCTGG - Intronic
1010945092 6:81964616-81964638 TCCTCACCTTCAGTTCAGCCTGG - Intergenic
1012840643 6:104325029-104325051 TCGTCTCCCTTCTTTCTCCCTGG - Intergenic
1012961998 6:105631753-105631775 TCTTCTCCTGTCTTACTGCCAGG + Intergenic
1013156286 6:107493316-107493338 TACATTCCTTTCTTTCTGCCGGG - Intronic
1013796652 6:113896194-113896216 TGCTCACCTGTTTTTCTGCATGG - Intergenic
1013854944 6:114560999-114561021 TCCTGCCCTTTCTTTCTACTGGG - Intergenic
1014190720 6:118493849-118493871 TCCATATCTATCTTTCTGCCTGG - Intronic
1014829345 6:126083271-126083293 CTCTAACCCTTCTTTCTGCCTGG + Intergenic
1015318383 6:131843627-131843649 TCCCCACCTTTCCCTCTCCCAGG + Intronic
1016300908 6:142630391-142630413 GCCTCACCTTCCTTCCTTCCAGG + Intergenic
1016738779 6:147507820-147507842 ACCCCACCCTCCTTTCTGCCCGG - Intergenic
1017605813 6:156131583-156131605 TCTTCACCTTTCTTCCTGTTTGG - Intergenic
1017818219 6:158030230-158030252 TCCTCACTTTTGCTTCTACCTGG - Intronic
1017992398 6:159503027-159503049 TCCTCACCCTTCTTTTCCCCAGG + Intergenic
1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG + Intergenic
1019737211 7:2656519-2656541 CCCTCACCTCTTTTGCTGCCAGG - Exonic
1021171077 7:17398623-17398645 TCATCCCCTTACTTGCTGCCAGG + Intergenic
1021599913 7:22355276-22355298 TACTCATGTTTCTTGCTGCCTGG - Intronic
1022237448 7:28475717-28475739 AACTCTCCTTTCTTCCTGCCTGG + Intronic
1022479064 7:30731249-30731271 TCCTCAAGTTTCTGTCTGCATGG + Intronic
1023466513 7:40461775-40461797 TCCACTCCTTCCTTTCTCCCTGG - Intronic
1024094956 7:45976049-45976071 GCTTCAGCTTTCTTTCTTCCTGG - Intergenic
1024256049 7:47540716-47540738 TCCTCACCTCTTTTCCTGTCTGG - Intronic
1027299069 7:76810451-76810473 TCTTCATCCTCCTTTCTGCCTGG - Intergenic
1028265380 7:88717716-88717738 TCTTCACGTTTCTTTCTTTCTGG - Intergenic
1030102482 7:105958452-105958474 TCATCACCTTTATATCTGCGGGG - Intronic
1032877872 7:136057082-136057104 TCCTCTCATTTCTTTTTTCCAGG - Intergenic
1033290620 7:140079676-140079698 TGCTCACCCTGCTTTCTGCCAGG + Intergenic
1033291398 7:140086610-140086632 TCTTCCCCTTTCTTTCCACCTGG + Exonic
1034016669 7:147595047-147595069 TCCTCCCCTCACTTTCTGCTTGG + Intronic
1034551085 7:151821038-151821060 TCCACAGCTTTCCTTCTGGCCGG - Intronic
1035703931 8:1660244-1660266 ACCTGACCTTTCTCTCTGGCTGG + Intronic
1036474156 8:9077890-9077912 ATCCAACCTTTCTTTCTGCCAGG + Intronic
1036677989 8:10850939-10850961 TCCTAAGCTTTCCTTCTCCCTGG + Intergenic
1036775947 8:11613289-11613311 TCCTGGCCTGTCTGTCTGCCCGG - Intergenic
1036996257 8:13660506-13660528 TCCTCAACATTATTTCTTCCTGG - Intergenic
1037154958 8:15688725-15688747 TCCTCTCCTCTCTGTATGCCAGG + Intronic
1037607519 8:20450088-20450110 TCATCTCCTTCCTTTCTCCCTGG - Intergenic
1038131039 8:24731965-24731987 TTCTCACCTCTCTTTTTGCAGGG - Intergenic
1040634962 8:49262454-49262476 CCTTCCCCTTTCTTTCTGCGTGG + Intergenic
1041797851 8:61764541-61764563 TACTTACCCTTCTTTCTGCAAGG - Intergenic
1043507052 8:80912521-80912543 TACTCACCTTTCTCTCTGCATGG - Intergenic
1045280287 8:100743926-100743948 TCCTCACCTTCCTTCCTTACAGG + Intergenic
1045494119 8:102693894-102693916 CACTCACCATTCCTTCTGCCCGG - Intergenic
1045501511 8:102747616-102747638 GCCGCACCTTTCCTGCTGCCTGG + Intergenic
1046804863 8:118469015-118469037 TCCGCACTATTCTTTCTGCCTGG + Intronic
1047533016 8:125694381-125694403 TCTTCTCCTTTCTTGCAGCCAGG - Intergenic
1048590944 8:135820350-135820372 TGGTGACCCTTCTTTCTGCCTGG + Intergenic
1050264626 9:3877167-3877189 TCATCACATTTCATTCTGCCTGG - Intronic
1052069187 9:24060314-24060336 TCCTCACTTTACTTACTACCTGG + Intergenic
1055358831 9:75466855-75466877 TCATCAGCTTGCTTTCTGTCTGG + Intergenic
1057409613 9:94806297-94806319 TTCTCAATTTTCTTTCTGCATGG + Intronic
1057423728 9:94931886-94931908 TCCTCACCTCTCTTGCTGGCAGG + Intronic
1057883464 9:98810010-98810032 GGCTCACCTTTCTCTCTGGCTGG - Intronic
1059426054 9:114221702-114221724 CCCTCACATTTCCTTCTTCCAGG - Intronic
1059533940 9:115063745-115063767 TCCTCCCCTTTGTCTCTGCTCGG - Intronic
1060153700 9:121304381-121304403 TTCTCACCTCTCCTTCTGCAAGG - Intronic
1061123212 9:128656858-128656880 TCGTTACTTTTCTTTCTTCCAGG - Intergenic
1061427765 9:130510931-130510953 TCATCACCTAGCTTTCTGCTTGG - Intergenic
1061995066 9:134179016-134179038 TGCTCTCATTTCTTCCTGCCCGG + Intergenic
1185942784 X:4339737-4339759 TCTTCTCCTTTCTTTCTGAGAGG - Intergenic
1188244030 X:27820099-27820121 TCCTCACCTTTACTTCTGTTAGG - Intronic
1188498501 X:30802296-30802318 TCCTTGCCTTGCCTTCTGCCTGG + Intergenic
1190159577 X:48021603-48021625 TCTTCACGTTTCTTTCTCCGTGG - Intronic
1195421732 X:104683159-104683181 TCCTCACTTTTCTCCCTGCCTGG + Intronic
1195492105 X:105482998-105483020 TCCTCTCATTTCTTTCTTCCAGG + Intronic
1195592510 X:106646696-106646718 TTCACGCTTTTCTTTCTGCCTGG - Intronic
1196098494 X:111824624-111824646 TCCTCACATTGCTGTCTACCTGG - Intronic
1196128296 X:112124130-112124152 TAATCACCATTCTTTCTGACTGG - Intergenic
1197176024 X:123486456-123486478 TCCCAACCTTTCTTTCACCCTGG - Intronic
1197522878 X:127521263-127521285 ACCTGACCTTTCTCTCTGGCTGG - Intergenic
1197804285 X:130384515-130384537 TCCTCCTCTTTCTCTCGGCCAGG - Exonic
1198394929 X:136211361-136211383 TCCTGTCTTTTCATTCTGCCTGG + Intergenic
1198483523 X:137063443-137063465 TCCTCATCTTTCATTCTCTCAGG - Intergenic
1200685875 Y:6258392-6258414 TCTTCACCTTTCTTTCTCACAGG - Intergenic
1200840352 Y:7775456-7775478 TCCTTTCCTTTCTTTCTTCATGG - Intergenic
1200991407 Y:9349639-9349661 TCTTCACCTTTGTTTCTCACAGG - Intergenic
1200994063 Y:9369916-9369938 TCTTCACCTTTGTTTCTCACAGG - Intronic
1200996727 Y:9390250-9390272 TCTTCACCTTTGTTTCTCACAGG - Intergenic
1200999242 Y:9458802-9458824 TCTTCACCTTTGTTTCTCACAGG - Intergenic
1201001895 Y:9479112-9479134 TCTTCACCTTTGTTTCTCACAGG - Intronic
1201004562 Y:9499400-9499422 TCTTCACCTTTGTTTCTCACAGG - Intergenic
1201007215 Y:9519725-9519747 TCTTCACCTTTGTTTCTCACAGG - Intergenic
1201009858 Y:9540078-9540100 TCTTCACCTTTGTTTCTCACAGG - Intergenic
1201133987 Y:10976522-10976544 TCCACTCCTTTCTTTCCACCGGG + Intergenic
1201623619 Y:15988205-15988227 TTCTCCACTTTTTTTCTGCCAGG - Intergenic