ID: 977745745

View in Genome Browser
Species Human (GRCh38)
Location 4:100545005-100545027
Sequence ATTGAGAAGACCAAAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977745745 Original CRISPR ATTGAGAAGACCAAAGATAA AGG Intronic
900279465 1:1856866-1856888 ATTCAGAAGGCCCAAGAAAAAGG + Intronic
901405433 1:9041804-9041826 ATTCCGAAGACCAAAGATCTGGG + Exonic
901943264 1:12680210-12680232 AGTGAGAAGACAAAGGAAAAAGG + Intergenic
903062054 1:20675814-20675836 ATTAAGAAGACCAAAATAAATGG - Intronic
905016733 1:34783013-34783035 ATTAATAAGACCAAAAAAAAAGG + Intronic
905949461 1:41936498-41936520 GTGGAGTAGACCAAACATAATGG - Intronic
906290861 1:44618502-44618524 GTTGAGAAGGGGAAAGATAAAGG - Intronic
906701579 1:47862785-47862807 AAGGAGAAGAACAAAGTTAAAGG + Intronic
906867939 1:49442677-49442699 ATTTACAATAGCAAAGATAATGG - Intronic
906890991 1:49714697-49714719 ATTTACAATAGCAAAGATAATGG - Intronic
908136097 1:61134297-61134319 ATTGAGAAGCAAAGAGATAAAGG - Intronic
909206473 1:72764292-72764314 ATTGAGACATCCAAAGATACAGG + Intergenic
909282513 1:73772680-73772702 ATTTAAAAGACAAAACATAATGG + Intergenic
909686116 1:78350935-78350957 ATTGAGAAGAACAAAGCAGAAGG - Intronic
911185899 1:94904794-94904816 AATGAGAAGACAAATGATACTGG - Intronic
911468356 1:98283441-98283463 ACAGAGAAGACCAAAAAGAATGG - Intergenic
911485880 1:98504519-98504541 ATTGGGAAGACAGAAGATGAGGG - Intergenic
911578584 1:99607875-99607897 ATTCACAATAGCAAAGATAATGG - Intergenic
912567205 1:110596547-110596569 GTAGAGAAGACCAAAGAGACAGG - Intronic
913355209 1:117913622-117913644 ATTGAGAGGCCCAAACCTAAAGG + Intronic
913700679 1:121370921-121370943 ATTGAGAAAAACAAAAAGAATGG - Intronic
914041228 1:144051383-144051405 ATTGAGAAAAACAAAAAGAATGG - Intergenic
914136857 1:144909103-144909125 ATTGAGAAAAACAAAAAGAATGG + Intronic
915995087 1:160553774-160553796 AGTGACCAGGCCAAAGATAAAGG + Intronic
916617879 1:166461658-166461680 TTTCAAAAGACCAAAGAGAAAGG - Intergenic
916633755 1:166645348-166645370 ATTCACAAGAGCTAAGATAATGG + Intergenic
916658035 1:166895036-166895058 ACTAAGAAGACAAAATATAAAGG - Intergenic
918670857 1:187214594-187214616 TTTTAGAAGGCAAAAGATAAAGG + Intergenic
918817318 1:189205224-189205246 ATTTAGAAGACCATGGATGAGGG - Intergenic
919005412 1:191892807-191892829 CTGCAGAAAACCAAAGATAAAGG + Intergenic
919555270 1:199045490-199045512 TTTAATATGACCAAAGATAAGGG - Intergenic
920106059 1:203554489-203554511 ATTGAGGATAGCGAAGATAAAGG + Intergenic
920488096 1:206389654-206389676 ATTGAGAAAAACAAAAAGAATGG - Intronic
922682412 1:227611546-227611568 CTTGAGAAGAACACAGATGAAGG - Intronic
922990826 1:229909749-229909771 CTTGAGAAGACTAAAGCTCAAGG - Intergenic
923222001 1:231903764-231903786 AGTGAGAACAGCAAAGAAAAGGG + Intronic
924284594 1:242473272-242473294 ATTGGGAAGACAAAAGAAACTGG + Intronic
1063624303 10:7675058-7675080 ATTCAGAACAGCAAAGATGAAGG - Intergenic
1065622858 10:27600917-27600939 AGTGAGAAGGGCAACGATAAAGG + Intergenic
1066314232 10:34227982-34228004 ATTTACAATAGCAAAGATAATGG + Intronic
1067245195 10:44535365-44535387 TTTCTGAAAACCAAAGATAAAGG - Intergenic
1067374415 10:45714234-45714256 ATTAAGGAGACCAAAGAGACAGG + Intergenic
1067882226 10:50055871-50055893 ATTAAGGAGACCAAAGAGACAGG + Intergenic
1068291814 10:55012790-55012812 ATTCTGAAGAGGAAAGATAAAGG - Intronic
1068553448 10:58431881-58431903 ATTCAGAAGACCTCAGAGAAGGG + Intergenic
1069147041 10:64906281-64906303 ATTTAGAAGAGACAAGATAAGGG - Intergenic
1070470377 10:76773365-76773387 ATTGAGAAGACGAAATAAGAGGG - Intergenic
1071276817 10:84063183-84063205 TTTGATAACACCAAAGATTATGG - Intergenic
1073792643 10:106955594-106955616 AGTGTGAATCCCAAAGATAAGGG + Intronic
1073965208 10:108981007-108981029 ACTTAGAAAAGCAAAGATAAGGG - Intergenic
1074012295 10:109494753-109494775 ATTGAGAAAAATAAAAATAAGGG + Intergenic
1074641759 10:115392186-115392208 TTTGTGAAGACAAAAGATTATGG - Intronic
1075492821 10:122888074-122888096 ATTGAGGAGACCAAGGCTAAAGG - Intergenic
1075501339 10:122977749-122977771 ATTGACAACACCAAATATGAGGG + Intronic
1076239872 10:128896495-128896517 ATGGAGAAGAGCAAAGGCAAAGG - Intergenic
1078025166 11:7688153-7688175 AAAGGGAAGACCAAAGAAAAAGG - Intergenic
1078327142 11:10389853-10389875 AAGGAGAAGAACAAAGAAAATGG - Intronic
1079515480 11:21262850-21262872 AAAGAGAAGACCAAGGAAAAAGG - Intronic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1080808342 11:35677360-35677382 AGAAAGAAGACCAAAGAGAAGGG - Intronic
1080949177 11:37009048-37009070 ATTCACAATACCAAAGATATAGG - Intergenic
1082847332 11:57737101-57737123 GTTGAGGAAACCAAAGCTAAGGG + Intronic
1082957392 11:58885082-58885104 GATGAAAAGACCAAAGGTAAAGG - Intronic
1082972978 11:59043148-59043170 AATGAAAAGACCAAAGATAAAGG - Intronic
1083414851 11:62518789-62518811 CTTGAAAGGACCAAAGATAAAGG - Exonic
1086185252 11:84005802-84005824 ATTAAAAAGACAAAAAATAACGG + Intronic
1087821606 11:102718736-102718758 ATTGAGAAGAATCAAGATAGTGG + Intronic
1087952618 11:104242040-104242062 GTTGATAAGACAAAAGGTAACGG + Intergenic
1088850373 11:113699030-113699052 TTAGAGAAGAACAAAGAGAAAGG + Intronic
1090726371 11:129530719-129530741 ATTGAGAAGAGGAAATCTAAAGG - Intergenic
1090906060 11:131075581-131075603 ATGGAGAAAACCCAAGATCAGGG - Intergenic
1092112976 12:5977050-5977072 ACTGAGAAGATAAATGATAATGG - Intronic
1093081460 12:14816502-14816524 ACTGTGAAGAAGAAAGATAAAGG - Intronic
1093106246 12:15091019-15091041 ACTGGGAAGATCAAAGATAACGG - Intergenic
1094788714 12:33883440-33883462 ATTCAGAATAGCAAAGACAAGGG + Intergenic
1095093923 12:38134576-38134598 AAACAGAAGAGCAAAGATAAGGG + Intergenic
1095616208 12:44192386-44192408 AGGGAGAAGACCAAATAAAATGG + Intronic
1095669410 12:44840972-44840994 ATTAAAAATACCAAATATAAGGG - Intronic
1095669882 12:44846492-44846514 ATTGACATGACAAATGATAATGG - Intronic
1097316833 12:58180664-58180686 ATTGTGAAAATGAAAGATAATGG - Intergenic
1097800447 12:63908143-63908165 CTTGAAAAGAACAAAGTTAAAGG - Intronic
1098158580 12:67625190-67625212 AATGAGGAGACCAAAGAGACTGG - Intergenic
1098291847 12:68964040-68964062 ATTGACAAGACAAAGGAAAAGGG + Intronic
1100009057 12:89931546-89931568 ATTGACAAGGCCAAAGGTAAGGG - Intergenic
1100094690 12:91018765-91018787 CTTCAGAAAACCAAAGACAAAGG + Intergenic
1100151918 12:91748790-91748812 ATTGAGATGGCAAAAGATGATGG + Intergenic
1100768974 12:97900202-97900224 ATTGAAAGGAACACAGATAATGG - Intergenic
1101046152 12:100808225-100808247 ATTAAGAAGTCAAAAAATAAAGG - Intronic
1101231827 12:102749171-102749193 ATTGTGAAGAATAAAGATAATGG - Intergenic
1102755552 12:115336749-115336771 AGTGAGAAGACTAAAGTAAAGGG - Intergenic
1104216641 12:126740395-126740417 AGTGAGAAGTCCAAAGCAAATGG + Intergenic
1105776666 13:23668598-23668620 ATTTAGAAGACCTAAAATTACGG + Intronic
1105900709 13:24749660-24749682 ATTGAGAACCCAAAAGCTAATGG + Intergenic
1105987683 13:25584754-25584776 ATTTAGAAGACCACGGAGAATGG + Intronic
1106713278 13:32360956-32360978 ATTGAGAAGACCAAAGATGGAGG + Intronic
1107758933 13:43655435-43655457 ATAGAGAAGACAGAAGATAAAGG - Intronic
1107870632 13:44743480-44743502 ATTGTGAAGAGCAAAGAAACTGG - Intergenic
1109653889 13:65365321-65365343 ATAAAGAAAACCAAACATAAAGG - Intergenic
1109843345 13:67949930-67949952 AATGAGAAGACTAAAGAACAAGG - Intergenic
1109861807 13:68209439-68209461 TTTGAGAAGAATAAAGAAAAGGG - Intergenic
1111481167 13:88828838-88828860 ATTGAAAAGTCAAAAAATAATGG + Intergenic
1112649130 13:101372922-101372944 ATTGAGAAGACATAAAAAAATGG + Intronic
1114922443 14:27350040-27350062 CTTGAGAACACTAAAGATATTGG - Intergenic
1115721518 14:36166665-36166687 ACTGTTAAAACCAAAGATAAAGG - Intergenic
1115841053 14:37470728-37470750 AATGAGAAGACACAAGTTAAAGG + Intronic
1116012580 14:39368042-39368064 TGTCAGAACACCAAAGATAAAGG - Intronic
1116333620 14:43628261-43628283 ATAAAAAAGACTAAAGATAAGGG + Intergenic
1117212650 14:53517022-53517044 ATTGACAAGATCAAAGATTAGGG - Intergenic
1117566032 14:56994470-56994492 TTTCAGAAGTCCTAAGATAATGG - Intergenic
1118467550 14:66044675-66044697 CTTGAAAAGACAAAAGAAAATGG + Intergenic
1118721363 14:68596507-68596529 ATTGGGAAGAGCAAAACTAAGGG + Intronic
1118914186 14:70088070-70088092 ATTGAGAATACAAAAGATTCAGG + Intronic
1118954158 14:70464562-70464584 AGTGTGAAGACCCAAAATAATGG - Intergenic
1120248745 14:82036587-82036609 ATTTAGCAGAGCAAAGAAAAGGG - Intergenic
1120275943 14:82372129-82372151 ATAGAGGAGACAAAAGAAAAGGG + Intergenic
1121094605 14:91207588-91207610 CTTCAGAAAACCAAAGATAAAGG + Intronic
1121131670 14:91453086-91453108 AATGAGAAAACCAAGGCTAAAGG + Intergenic
1121641480 14:95487348-95487370 AGTGAGAAGACCAAGGATTGGGG + Intergenic
1123914620 15:25010604-25010626 ATTCAGAATACTAAAAATAAAGG - Intergenic
1125042202 15:35202297-35202319 ATTGAGAAGATCAAGGATGGTGG + Intergenic
1125654544 15:41345394-41345416 CTTGAAAAGGCCAAAGATAAAGG + Intronic
1126215815 15:46153676-46153698 ATTGTCAAGACCAAAGGTGATGG + Intergenic
1126260824 15:46688710-46688732 ATTGAAAAGAGCAAAGTTGAAGG + Intergenic
1126347201 15:47708812-47708834 ATTCAGAAGACCCAAGTTCAAGG + Intronic
1126353715 15:47772135-47772157 AATGGGAAGACCACACATAATGG - Exonic
1127083919 15:55407640-55407662 ATTAGGGAGACCAAAGCTAAAGG + Intronic
1127284509 15:57520756-57520778 ATTGAGACAACCAAGGAAAAAGG + Intronic
1127408062 15:58674116-58674138 GTTGAGAAGGCCACAGATATGGG - Intronic
1127611159 15:60638908-60638930 ATTAAGAAGAGCTAAGAAAAGGG - Intronic
1128890091 15:71323640-71323662 ATTGATAGGAAGAAAGATAAAGG + Intronic
1130755382 15:86757473-86757495 ATTGAGAAGATCAAAAGAAATGG - Intronic
1131010561 15:89014404-89014426 CTTGAGAAGAACAAAGTTAGAGG + Intergenic
1132022262 15:98372905-98372927 ATTGAGAATGAAAAAGATAACGG + Intergenic
1135703339 16:24652607-24652629 ATGAAGAACACCAAAGAAAAAGG - Intergenic
1137308115 16:47225305-47225327 ATTAAGAATACCAACAATAATGG + Intronic
1137319197 16:47361955-47361977 ATTTAGCAGACCTAAGATGAGGG - Intronic
1137348806 16:47691801-47691823 AATGAAAAGACAAAAAATAAAGG + Intronic
1138616807 16:58174651-58174673 AATGGGAAGACTAAAGATGAAGG + Intronic
1140032752 16:71351533-71351555 AATGAGATGTTCAAAGATAAGGG - Intergenic
1144001719 17:11061274-11061296 ACTGAGAAGTCCAAAGTCAAAGG + Intergenic
1147542998 17:41376776-41376798 ATGGATAAGACCAAAGATCTAGG + Intronic
1149050797 17:52302252-52302274 AGTGAGAAGAACATAGACAAAGG + Intergenic
1149839856 17:59952008-59952030 ATGGAGAAGACTAATTATAAGGG + Intronic
1151022610 17:70635273-70635295 ATTGAAAAGAAGAAAGATAATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153520094 18:5943596-5943618 AGTCAAAAGACCAAAGAAAAAGG + Intergenic
1155135925 18:22992607-22992629 ATTTAGATGACAAAAGAGAAGGG - Intronic
1155192741 18:23445535-23445557 AAAGAGAAGAACAAAGTTAAAGG + Intergenic
1155690725 18:28619137-28619159 ATTAAGAAAACCAAAGATTCAGG + Intergenic
1156128322 18:33935834-33935856 ATTGAGAAACTCAAAGATACAGG + Intronic
1156289365 18:35732488-35732510 ATTTAAATGACCAAAGTTAAGGG + Intergenic
1157090415 18:44630331-44630353 ATTGGGAAGACAAAAGAGAAGGG - Intergenic
1158238098 18:55342290-55342312 ATTGATAACAGCAAAGAAAATGG - Intronic
1158622533 18:59045495-59045517 AATGAGACAACCAAAGTTAAGGG + Intergenic
1161898553 19:7100489-7100511 ATTGAGAAGAGACAAGTTAAAGG + Intergenic
1162195501 19:8981346-8981368 ATTGAGAAGACCAAATCTCAGGG + Intergenic
1163214938 19:15869583-15869605 ATGAAGAAGACAAACGATAAAGG + Intergenic
1164391856 19:27830167-27830189 CTTGAAAAGACCAAAGTGAAAGG - Intergenic
1164455303 19:28401899-28401921 AGGGAGAAGACAAAAGAAAACGG - Intergenic
925574330 2:5345137-5345159 ATTCAGATGACCATGGATAAGGG + Intergenic
925936507 2:8766868-8766890 ATTGAGATTTCTAAAGATAAAGG - Intronic
926206743 2:10839370-10839392 ATTGAGAAGACCCAAGAAATGGG - Intergenic
928063233 2:28136220-28136242 ATTGAGAAGATCTAAGAACATGG - Intronic
930551463 2:52840224-52840246 CTTTATATGACCAAAGATAAAGG - Intergenic
930625158 2:53688601-53688623 ATTGAGGAAACCAAAGCTCAGGG + Intronic
930720158 2:54630682-54630704 ACTGTGAACACCAAATATAATGG - Intronic
930927327 2:56834419-56834441 ATTGAGAAATACAAATATAATGG - Intergenic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
932774328 2:74518342-74518364 ATTTAGAAGCCCAAAGTTTAGGG - Exonic
933697007 2:85227181-85227203 GAAGAGAAGTCCAAAGATAAAGG - Intronic
933829709 2:86197063-86197085 ATTAAGAAGTTCAAAGACAAGGG - Intergenic
936034566 2:109100574-109100596 ATTAAGAAGTCCAAAGGTGACGG + Intergenic
936442307 2:112565329-112565351 ATTGAGTATACAGAAGATAAAGG - Intronic
936660749 2:114540981-114541003 ATTTAAAAGACCAAAGAGATTGG - Intronic
937302993 2:120854588-120854610 ATCGTGGAGACCAAATATAATGG - Intronic
938222710 2:129585152-129585174 AATGAGAAGAACAAAGTTGAAGG + Intergenic
938377545 2:130818770-130818792 ATAGAGAAGGACAAAGACAATGG + Intergenic
940566036 2:155361510-155361532 ATTGAGAATATCAAAGATTTTGG + Intergenic
940781159 2:157935007-157935029 ACTGAGAAGAGATAAGATAAGGG + Intronic
941567680 2:167129171-167129193 AAAGAGAAGAGCAAAAATAAAGG - Intronic
942908726 2:181215334-181215356 ATTGAGAAGTCCAAAGTCAAGGG - Intergenic
943296000 2:186140002-186140024 AGTGAGAAAATCAAAGATATTGG - Intergenic
943919987 2:193694096-193694118 ATTGAGAAAAACAAAGAAACTGG - Intergenic
945346064 2:208718164-208718186 ATCCAGAAGATCTAAGATAATGG - Intronic
945473326 2:210252569-210252591 ATTGAGAAGATAAACTATAAAGG - Intergenic
945816365 2:214609636-214609658 ATAGAGAAGACCAACAATCACGG + Intergenic
945837931 2:214854397-214854419 ATTTAGAAGGACAAAGAGAAAGG - Intergenic
946146259 2:217733419-217733441 ATTTAAAAGACAAAAGGTAAGGG + Intronic
946490317 2:220143230-220143252 AGTGAGAAGGCAAAAGATGATGG - Intergenic
947308137 2:228770209-228770231 ACTAAGAAGACCATAGTTAAAGG - Intergenic
1170399864 20:15970239-15970261 AGATAGAAGGCCAAAGATAAAGG + Intronic
1170600904 20:17840883-17840905 ATGGCTAAGACCAAAGCTAAGGG + Intergenic
1170689484 20:18600540-18600562 AAAGAGAAGAACAAAGTTAACGG - Intronic
1171096465 20:22336803-22336825 ATTCTGAAGCCCAAAGATAGGGG - Intergenic
1174357955 20:50010573-50010595 ATTAATAAGATCAAAGTTAAGGG + Intergenic
1177587655 21:23119316-23119338 GCTGAGAAGTCCAAAGTTAAGGG + Intergenic
1177813052 21:25945491-25945513 AAAAAGAAGAACAAAGATAACGG + Intronic
1177931568 21:27291553-27291575 CTTAAGAAGATCAAAGATTAAGG - Intergenic
1180004707 21:45015001-45015023 ATTGAGATGAGCAAAGATCCTGG - Intergenic
949460331 3:4284815-4284837 AATGAGAAAAGCTAAGATAAAGG + Intronic
950778780 3:15373334-15373356 GTTGGGAAGACCAGAGAAAAAGG - Intergenic
950897103 3:16462851-16462873 AATGATAAAGCCAAAGATAAAGG + Intronic
951172688 3:19560466-19560488 ATTGAGAAAACAAAAGAAATTGG - Intergenic
951438885 3:22698705-22698727 CTGCAGAAAACCAAAGATAAAGG + Intergenic
951678244 3:25266400-25266422 ATTGAGGTCAACAAAGATAAGGG - Intronic
955626233 3:60922414-60922436 AATGTGAAGGTCAAAGATAATGG - Intronic
956285734 3:67608161-67608183 CTGGAGGAGACCAAAGACAAGGG - Intronic
957700475 3:83704044-83704066 TTTAAGAAGATCAAAGAGAATGG + Intergenic
957796533 3:85016345-85016367 ATTGGGATGACCAGAGAAAATGG + Intronic
959165354 3:102770329-102770351 ATTGAGTTCACCAAATATAATGG - Intergenic
959178241 3:102945257-102945279 AGTGAGAATATCAAAAATAATGG + Intergenic
959660905 3:108867437-108867459 TTTGAGAAGAACTGAGATAATGG + Intergenic
959685410 3:109140495-109140517 ATTGAGACAACCAAGTATAAAGG - Intergenic
961231021 3:125309297-125309319 ATTGAGAACACAAAATTTAAAGG + Intronic
961416336 3:126760501-126760523 GTTGACAGGACCAAAGATATGGG - Intronic
961994070 3:131222455-131222477 ATAGAAAAGAACAAAGCTAAGGG - Intronic
963472724 3:145762982-145763004 ATTGAGAAGACTGCATATAAGGG + Intergenic
963987347 3:151612053-151612075 AAGGGGAAGACCAAAGAGAAAGG - Intergenic
964063247 3:152551439-152551461 TTTGAGAAGACAAGTGATAAAGG - Intergenic
965140005 3:164820503-164820525 ATTGAAAACACCAAAATTAATGG - Intergenic
965447689 3:168796016-168796038 AATGAGAAGATCCAAGAAAAAGG + Intergenic
965447906 3:168798841-168798863 AATGAGAAGATCCAAGAAAAAGG + Intergenic
965819523 3:172670892-172670914 ATCTAGGAGAGCAAAGATAATGG - Intronic
966032697 3:175370227-175370249 ATCCAGGAGAGCAAAGATAATGG + Intronic
966660914 3:182413554-182413576 ATTGAGAAGAAAAATGCTAAGGG + Intergenic
967640400 3:191855881-191855903 AGTGAGAAGAGCACAGAAAATGG - Intergenic
967689961 3:192462519-192462541 ATTGAGAAGTCCAAAATTGAGGG - Intronic
968834873 4:2955725-2955747 AATGAAAAGAGCAAAGACAAAGG + Intronic
970725204 4:19035881-19035903 ATAAAGAAGACCAAAGAAATCGG - Intergenic
970741167 4:19239341-19239363 ATTTTGAAGACAAAAGAAAAAGG + Intergenic
970766935 4:19561131-19561153 ATTTATAAGACTAAAGAAAAAGG - Intergenic
971729471 4:30359328-30359350 ATGGAGAATAGAAAAGATAAGGG - Intergenic
971979829 4:33737389-33737411 ATTCACAAGAGCAAAGATATGGG + Intergenic
972849588 4:43032512-43032534 AATGAGGGGACCAAACATAAGGG + Intergenic
973023491 4:45235082-45235104 CTGAAGAAAACCAAAGATAAAGG - Intergenic
973066085 4:45795136-45795158 ATTAAGAGGACAAAATATAAAGG - Intergenic
973222345 4:47742802-47742824 TTTAAGAAGAACAAAGATAGAGG + Intronic
973287738 4:48438912-48438934 ATAGAGGAGACAAAAGAAAAAGG - Intergenic
973701087 4:53538010-53538032 ATTCTGAATACCAAAGATTAGGG + Intronic
975125469 4:70777695-70777717 AATGAGAATACCTAACATAAAGG + Intronic
975184570 4:71386344-71386366 ATTCAAGAGTCCAAAGATAAAGG - Intronic
975799334 4:78043248-78043270 ATTGAGTATACCAGAGACAATGG - Intergenic
976383118 4:84423210-84423232 ATTCAGAGGAACAAAGATAAGGG + Intergenic
976423086 4:84868233-84868255 ATTAAGAAGAAGAAAGAAAAAGG - Intronic
977103962 4:92856356-92856378 AATGGAAAGACCAAACATAATGG - Intronic
977745745 4:100545005-100545027 ATTGAGAAGACCAAAGATAAAGG + Intronic
977941242 4:102861796-102861818 ATTGACTAGACAAAAGATTATGG - Intronic
980017674 4:127671680-127671702 ATTCACAATAGCAAAGATAATGG + Intronic
980715816 4:136627224-136627246 ATAGACAAGACCAAATATGAAGG - Intergenic
980791555 4:137626998-137627020 GTTGAGAAAGGCAAAGATAAAGG + Intergenic
980796332 4:137688461-137688483 ATTGAGAAGAGGTAAAATAAAGG + Intergenic
981239799 4:142463497-142463519 ATTAAGAACAGCAAAGAGAAAGG - Intronic
982185435 4:152792582-152792604 ATTCAGAAGTCTAATGATAAAGG - Intronic
982361126 4:154520131-154520153 TTTCAGGAAACCAAAGATAAAGG + Intergenic
982610416 4:157567441-157567463 GTTGAGAAGACCAAGAACAAAGG - Intergenic
983822154 4:172208245-172208267 AATGAAAAGACAAAAAATAATGG - Intronic
984254336 4:177372828-177372850 ATTAAAAAAACCAAAGAAAATGG + Intergenic
984384439 4:179036732-179036754 ATTGAGAAGATGAGAGATATGGG + Intergenic
984867173 4:184291464-184291486 ATTGGTAAGAACAAAAATAAAGG - Intergenic
985081849 4:186273771-186273793 ATTGAAAGGAGCAAATATAAAGG + Intronic
985935883 5:3097556-3097578 ATTAAGATGGCCAATGATAATGG - Intergenic
986288689 5:6380246-6380268 ATCAAAAAGACCAAAGACAATGG + Intergenic
986521575 5:8624442-8624464 ATTGGGAAGTCCAAAAAGAAAGG - Intergenic
986644263 5:9901110-9901132 CCTGAGAAGACCACAGAGAAGGG + Intergenic
986739116 5:10690213-10690235 CTTGAGCAGACCAGAGCTAAAGG - Intronic
987159564 5:15127232-15127254 ATTAAGAAGTCAAAAAATAACGG - Intergenic
987694642 5:21311982-21312004 ATTGAGTAGCCCAAAGGCAAAGG - Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
988628659 5:32905297-32905319 CTTGAGAGGAACAAATATAAGGG - Intergenic
989454595 5:41628383-41628405 ATAGAGAAGCCCAAGAATAAGGG + Intergenic
989570830 5:42944616-42944638 ATTGAGAAGGGGAAAGAAAATGG - Intergenic
989581181 5:43034591-43034613 ATTGAGAAGGGGAAAGACAAAGG - Intergenic
989669709 5:43901356-43901378 ATTAAGAAGTCAAAAAATAACGG - Intergenic
989727140 5:44599754-44599776 ATTAAGAAGTCAAAACATAAGGG - Intergenic
991269400 5:64761925-64761947 ATTGAGAAAACCAAAAAGAAGGG + Intronic
991467632 5:66930528-66930550 AATGAGAAGAACAAAGGTAAAGG + Intronic
991745593 5:69737491-69737513 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991752113 5:69817742-69817764 ATTGAGTAGCCCAAAGACAGAGG - Intergenic
991797160 5:70317244-70317266 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991824971 5:70612805-70612827 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
991831433 5:70692847-70692869 ATTGAGTAGCCCAAAGACAGAGG - Intergenic
991889539 5:71316777-71316799 ATTGAGTAGCCCAAAGACAGAGG + Intergenic
992808829 5:80365189-80365211 ATTCACAAGAGCAAAGATATGGG - Intergenic
992840103 5:80680412-80680434 ATTCAGAAGACAAAAAAAAAAGG + Intronic
993505020 5:88698433-88698455 ATAGAGAACACCAATTATAAAGG - Intergenic
993782919 5:92090304-92090326 ATTGATAAAAACAAAGAGAATGG - Intergenic
994064318 5:95518965-95518987 ATTCAAAAGACAAAAAATAAAGG - Intronic
994480313 5:100326407-100326429 ATTGATAAGAACAAGGATAGTGG - Intergenic
994840336 5:104916060-104916082 ATTAAAAAGACCAAATACAAAGG - Intergenic
994953941 5:106502462-106502484 ATTGAGAATATCAAATATATAGG - Intergenic
995128665 5:108606878-108606900 AATTAGAAGACCAAAAATGAGGG + Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995731978 5:115255146-115255168 ATGGCAAAGACCAAGGATAATGG - Intronic
996099826 5:119435042-119435064 AGTGTGAAGACCAAAGTTTAAGG + Intergenic
996193427 5:120573428-120573450 ATTAATAAGACAACAGATAATGG - Intronic
997481334 5:134187035-134187057 ATTGAGGAGGCCAAGGATAGAGG + Intronic
998990794 5:147813799-147813821 TTTGAGAAAACCACAGAAAAAGG + Intergenic
999565092 5:152850790-152850812 CTTCAGAAAATCAAAGATAAAGG - Intergenic
1000150700 5:158497862-158497884 TGTGAAAAGACCAAAGATGAGGG - Intergenic
1001903315 5:175449627-175449649 GTAGAGAAGGACAAAGATAAGGG - Intergenic
1003609526 6:7597528-7597550 GTTGAGAGGAACAGAGATAATGG + Intronic
1004322799 6:14645969-14645991 ATACAGAAAACCAAAGATAAAGG - Intergenic
1005330390 6:24744328-24744350 ATTTAGAAACGCAAAGATAAAGG - Intergenic
1005556259 6:26987956-26987978 ATTGAGTAGCCCAAACACAAAGG + Intergenic
1006508739 6:34509507-34509529 ATTGAGAAGAACAAAGCTGGAGG - Intronic
1007641264 6:43341676-43341698 ATTGAGAAGTTTAAAGACAAAGG + Intronic
1008048308 6:46873986-46874008 AATGGGCAGACCACAGATAATGG - Intronic
1008189219 6:48433601-48433623 AGTGAGTAGCCCAAAGAGAAAGG + Intergenic
1009955683 6:70449684-70449706 ATTGACAATAGCTAAGATAATGG - Intronic
1010431639 6:75784463-75784485 ATGGAGAAGAGCAAAGTGAAAGG + Intronic
1010814387 6:80339851-80339873 ATTGAGAATAGCAATGATAAGGG - Intronic
1010924169 6:81723139-81723161 ACTGTGAAGACCAAAAAAAAGGG + Intronic
1010981015 6:82369598-82369620 ATTAAAAAGACAAAAGACAAAGG - Exonic
1011437372 6:87352606-87352628 AATGAGAAGATGAAAGCTAAAGG + Intronic
1012138956 6:95596711-95596733 ATAGAAAAGACCAAAAAGAAAGG - Intronic
1012204689 6:96445924-96445946 TTGGAGGAGAGCAAAGATAATGG - Intergenic
1013735148 6:113218053-113218075 CTTGGGAAAACCAATGATAATGG + Intergenic
1013819726 6:114139959-114139981 ATTGAAAAGAACAAAGACTAAGG - Intronic
1013862810 6:114657363-114657385 ATTGCAAATACCAGAGATAAAGG + Intergenic
1013962485 6:115917142-115917164 ATTGAAAAAACAAGAGATAAAGG + Intergenic
1014980605 6:127942307-127942329 AATGAGAAGATTAAAGAAAAAGG + Intergenic
1015693222 6:135950514-135950536 AATGAGAAAACCAAATATATGGG + Intronic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1016431411 6:143989801-143989823 AATGAAATGACCAAAGATTAGGG - Intronic
1017077228 6:150630469-150630491 ATTGGAAAGAAAAAAGATAAGGG + Intronic
1017406590 6:154126320-154126342 ATTAACAAGACCAGAGAGAAGGG + Intronic
1018214524 6:161514156-161514178 AATGAGAGAACCAAAGAAAAAGG + Intronic
1021024507 7:15647893-15647915 ATTGAGAAGTTTAAAAATAAAGG - Intronic
1021315326 7:19142374-19142396 ATGGAGAAGACTAACGAAAACGG + Intergenic
1022337370 7:29434377-29434399 ATTGAGAAGAAAAAAAAAAAAGG - Intronic
1022387616 7:29916307-29916329 ATTAAGAAGACCCTAGACAAAGG + Exonic
1022793213 7:33710167-33710189 AATGAGAAGTCCAAAAATAAAGG + Intergenic
1022827837 7:34034619-34034641 ATTGAGTAGAACACAGAAAAAGG - Intronic
1023376176 7:39557890-39557912 ATTCACAATAGCAAAGATAATGG + Intergenic
1024607100 7:51030910-51030932 CTAGGGAAGACCAAAGAGAAAGG + Intronic
1024689404 7:51782874-51782896 ATTGAGAATTTCAAAGATCATGG + Intergenic
1025950714 7:66143259-66143281 TTTGGGAAGACCCAAGAAAATGG - Intronic
1026225327 7:68435228-68435250 ACTGAGAAAATCAAAGATAAGGG + Intergenic
1026673668 7:72411121-72411143 ATTTATAAGAGCAAACATAAAGG + Intronic
1028383196 7:90222368-90222390 AATGAAATGACCAAAGAAAAAGG + Intronic
1028654637 7:93190481-93190503 ATTGAGAAGACAGAAGAAGAAGG + Intronic
1030169641 7:106588509-106588531 ACTGAGAAGGAGAAAGATAATGG + Intergenic
1030774109 7:113512647-113512669 ATCTAGAAAATCAAAGATAAGGG - Intergenic
1030788232 7:113689472-113689494 ATTAAAAAGACCAGAAATAAAGG + Intergenic
1030913918 7:115288628-115288650 ACTGAGCAGTCAAAAGATAAAGG + Intergenic
1031675637 7:124608745-124608767 ATTGAGAATAGCAAACAGAATGG + Intergenic
1035131663 7:156660259-156660281 TTAGAGAAGACCAAAGAAATTGG - Intronic
1035195921 7:157220223-157220245 ATTGTAAGGACCAAAAATAAGGG + Intronic
1038200197 8:25405113-25405135 AATTAGAAGTCAAAAGATAAAGG - Intronic
1038918650 8:32056408-32056430 GTTGAGAAAAGCAAAGAAAAAGG - Intronic
1039015958 8:33149123-33149145 ATTTTGAAGACCACAGATTAGGG - Intergenic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1043566467 8:81554184-81554206 ATCAAGGACACCAAAGATAATGG + Intergenic
1043663812 8:82782414-82782436 ATTGGTAAGCCGAAAGATAATGG + Intergenic
1044363279 8:91313417-91313439 CTTGAGAAGAACAAAGCTGAAGG - Intronic
1044700037 8:94957423-94957445 ATTTAGAAGAAAGAAGATAAGGG + Intronic
1046129589 8:109950294-109950316 AATGAGAAGAACTAAGTTAAAGG - Intergenic
1046237209 8:111440525-111440547 ATTGAGAATACAAAAATTAATGG + Intergenic
1046311513 8:112443043-112443065 AATGAGAAGGACAAAGAAAAAGG - Intronic
1046470925 8:114672722-114672744 TTTGAGAAGAAACAAGATAATGG + Intergenic
1046774629 8:118151149-118151171 ATACAAAAGAGCAAAGATAAGGG - Intergenic
1047870135 8:129073222-129073244 ATTGAGTAGACCCATGTTAAAGG - Intergenic
1048524840 8:135192917-135192939 TTTAAGAAGACGAAAGGTAAAGG - Intergenic
1049056796 8:140243211-140243233 GTTCAAAAGACCAAAGAGAAAGG + Intronic
1050824573 9:9929933-9929955 AATGAGGACACCAGAGATAATGG + Intronic
1050827882 9:9972303-9972325 CTTGAGAAGAGCAAAAATAGGGG - Intronic
1050955702 9:11656175-11656197 ATTGAGAAAGCAAAAGAAAATGG + Intergenic
1051523615 9:18017942-18017964 TTTTAGAACAACAAAGATAATGG - Intergenic
1051939429 9:22487656-22487678 ATTGAGAAGAACAAAGAAATGGG - Intergenic
1052000624 9:23275157-23275179 AAAGAGAAGATCAAAGATCACGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052376168 9:27719883-27719905 ATGAACAAGAGCAAAGATAAAGG - Intergenic
1052376170 9:27719945-27719967 ATCAACAAGAGCAAAGATAAAGG - Intergenic
1052502372 9:29308001-29308023 CTTGAGAAGACTGAAGAGAAAGG - Intergenic
1052761157 9:32592976-32592998 CTTGAGAAAACCAAAGATGAGGG + Intergenic
1052774257 9:32718197-32718219 AGTGAGAAGAGAAAGGATAAAGG - Intergenic
1052828657 9:33196895-33196917 TTTCAGAATACCAAACATAAAGG + Intergenic
1054252355 9:62731334-62731356 AAGGAGAAGACCAAAGAGCAGGG + Intergenic
1054996941 9:71402408-71402430 AGGGAGGAGACTAAAGATAAGGG - Intronic
1055247908 9:74269097-74269119 GTTGTGAAGATCAAAGATGATGG - Intergenic
1055442569 9:76351134-76351156 ACTGAGAAGATCTAAGATAATGG + Intronic
1055776893 9:79776113-79776135 ATTTAGAAGACAATAGAGAAAGG + Intergenic
1056039164 9:82643314-82643336 ATTAAAAAGACAAAAAATAACGG + Intergenic
1056272721 9:84962487-84962509 ACTCAGAAGACCAAAAAAAAAGG - Intronic
1056832335 9:89927393-89927415 ATTGAGAACACCAAACAGGAGGG - Intergenic
1057553829 9:96071984-96072006 AGAGAGAAGAACAAACATAAGGG - Intergenic
1057726142 9:97569713-97569735 GTTGTGAAGATCAAAGATGATGG - Intronic
1058547974 9:106081374-106081396 ATGTAGAAAACCAAAGATGAAGG + Intergenic
1058659130 9:107252890-107252912 AATGAGAAGACAAGAGAGAAGGG + Intergenic
1059044990 9:110856759-110856781 TTTGAGAAGAATAAAGACAATGG - Intergenic
1059904065 9:118962134-118962156 ATAGAGAAGTCCAGGGATAAAGG + Intergenic
1060342053 9:122786178-122786200 AAGGAGAAAACCAAAGTTAAGGG + Intergenic
1060606185 9:124916224-124916246 ATTGGGAAGTTGAAAGATAATGG + Intronic
1060628847 9:125138099-125138121 AATGAGAAGATTAAAAATAAAGG - Intronic
1187041712 X:15603457-15603479 AATTAGAAGACCAAAGATGCAGG + Intergenic
1187226968 X:17382740-17382762 AATGAGAAAAGCTAAGATAAAGG - Intronic
1187673621 X:21693205-21693227 ATTGAGAAGACCATAAAGACTGG - Intergenic
1188195759 X:27231002-27231024 ATTGAGAAAAACAAACAAAAAGG + Intergenic
1188720889 X:33521765-33521787 TTTGAGAATGCCAAGGATAAAGG + Intergenic
1188949245 X:36348215-36348237 ATTGAGATGACGAAAGCAAATGG + Exonic
1189118701 X:38370528-38370550 ATTGAGACAACCAAGTATAAAGG + Intronic
1189647663 X:43151469-43151491 TTTGAGAAGTGCCAAGATAATGG + Intergenic
1190438605 X:50453295-50453317 GATGAGAAAACCAAAGCTAAAGG - Intronic
1192395405 X:70775930-70775952 ATTAAAAAGACAAAAGTTAATGG + Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1192780841 X:74292639-74292661 TTTGAGAAGACCTGAGTTAAGGG - Intergenic
1193511166 X:82401385-82401407 ATTGACAATAGCAAAGATATGGG - Intergenic
1194428394 X:93769077-93769099 ATACAGAGGAACAAAGATAAGGG - Intergenic
1194589480 X:95781073-95781095 ATACAGAAGAACAAAGATAAGGG + Intergenic
1194818484 X:98475194-98475216 ATACAGAAGATCAAAGATAAGGG - Intergenic
1195170170 X:102259691-102259713 AGAGTGAAGAGCAAAGATAAAGG + Intergenic
1195188687 X:102427409-102427431 AGAGTGAAGAGCAAAGATAAAGG - Intronic
1195314688 X:103666086-103666108 ATACAGAAGACCCCAGATAAAGG + Intergenic
1195620746 X:106952100-106952122 AGTGACAAGATCAAAGATGAAGG - Intronic
1196294228 X:113980299-113980321 AATGAGAGAACAAAAGATAAAGG - Intergenic
1197549008 X:127864782-127864804 ATTCACAATAGCAAAGATAATGG + Intergenic
1197851671 X:130868580-130868602 AGTGAAGTGACCAAAGATAATGG - Intronic
1198221519 X:134606776-134606798 ATTCACAATAGCAAAGATAATGG + Intronic
1200628170 Y:5548174-5548196 ATGGATAAGAACAAAGATCACGG + Intronic
1200842785 Y:7800443-7800465 CATGATAAGGCCAAAGATAAAGG + Intergenic