ID: 977747289

View in Genome Browser
Species Human (GRCh38)
Location 4:100564622-100564644
Sequence CAACAGACCCCCCTTTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977747288_977747289 12 Left 977747288 4:100564587-100564609 CCAGGTTTTATTTGTCTTGGCAC 0: 1
1: 0
2: 2
3: 13
4: 213
Right 977747289 4:100564622-100564644 CAACAGACCCCCCTTTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977747289 Original CRISPR CAACAGACCCCCCTTTCATT TGG Intronic
No off target data available for this crispr