ID: 977747902

View in Genome Browser
Species Human (GRCh38)
Location 4:100573357-100573379
Sequence TGTAGTGAGTCTATAACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977747901_977747902 19 Left 977747901 4:100573315-100573337 CCAAACAATTTCAGTTGAGAAAT 0: 1
1: 0
2: 0
3: 34
4: 341
Right 977747902 4:100573357-100573379 TGTAGTGAGTCTATAACAATTGG 0: 1
1: 0
2: 0
3: 6
4: 93
977747900_977747902 20 Left 977747900 4:100573314-100573336 CCCAAACAATTTCAGTTGAGAAA 0: 1
1: 0
2: 0
3: 44
4: 376
Right 977747902 4:100573357-100573379 TGTAGTGAGTCTATAACAATTGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977747902 Original CRISPR TGTAGTGAGTCTATAACAAT TGG Intronic
905543218 1:38776765-38776787 TGTGGAGAGTATACAACAATGGG - Intergenic
907953199 1:59203819-59203841 TGTTGTTAGTCTATAACTGTTGG + Intergenic
907979491 1:59467598-59467620 TGTAGTAACTCTATAATAAAAGG - Intronic
908762321 1:67523586-67523608 TGTAGTGCTTCTCTAACAGTGGG - Intergenic
912802002 1:112725543-112725565 TGTAGGGAGTCAACAACAGTGGG - Intronic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
924587893 1:245375962-245375984 TATTATGATTCTATAACAATAGG - Intronic
1070354810 10:75629513-75629535 CGTTGTGAGGCTATAACACTCGG - Intronic
1072844070 10:98809080-98809102 TGGAGTGAGTCAATGTCAATTGG - Intronic
1075143645 10:119864299-119864321 TGTAGTGACTTTAAAACAAAAGG - Intronic
1077706363 11:4490057-4490079 TGTGATGAGTCTATGACAATGGG - Intergenic
1079724666 11:23866187-23866209 AGTACTGAGATTATAACAATAGG - Intergenic
1080184361 11:29462765-29462787 TGTAGTGAGTCAAGAATCATTGG - Intergenic
1080527510 11:33140903-33140925 TTTAATGTGTCAATAACAATTGG - Intronic
1087061342 11:93981495-93981517 TTTAATGAGTCTCTAACAAGAGG + Intergenic
1088614325 11:111609242-111609264 TTTTGTGAGTATATAACTATCGG + Intronic
1095916480 12:47485229-47485251 AGAAGTGAGTCTAGCACAATTGG + Intergenic
1095995679 12:48081862-48081884 TGTATTGAATCTAAAACATTTGG - Intronic
1096052580 12:48624116-48624138 TGTAGGGAGTCAATAACATGTGG + Intergenic
1099299614 12:80875415-80875437 TGTAGTAAGTGTATAAAAGTTGG - Intronic
1103176369 12:118867093-118867115 TGTATTGAGTCTTTAACAAATGG + Intergenic
1105776665 13:23668539-23668561 TGAGATGAGTTTATAACAATAGG + Intronic
1107130689 13:36891558-36891580 TGTAGAGAGTCTAAAACTCTGGG + Intronic
1107371284 13:39752164-39752186 TCTAGTAAATCTATAAAAATGGG + Exonic
1116044469 14:39727332-39727354 AGTAGTGATTCTAAATCAATGGG + Intergenic
1116926421 14:50642654-50642676 TGTGGTGTATATATAACAATGGG + Intronic
1117140253 14:52783631-52783653 TGTAGTGATTATAGAAGAATAGG - Intronic
1121693051 14:95891615-95891637 TGTAGCGAGTGTATAGTAATAGG - Intergenic
1128650722 15:69410820-69410842 TGTGGTGGGTCTCCAACAATGGG + Intergenic
1133993500 16:10728972-10728994 TGTGTTGAGTGTATAAGAATGGG + Intergenic
1138294142 16:55872316-55872338 TGGAGTGACTCTAAAACAAAGGG - Intronic
1145874470 17:28306817-28306839 TGTAGTCAGTCTAAGACAATTGG - Intergenic
1148010481 17:44476140-44476162 TGTAGTCAGTCTAAAAGAGTTGG - Intronic
1153699653 18:7679779-7679801 TTCTGTGAGTCTAAAACAATAGG + Intronic
928616327 2:33043286-33043308 CATAATGAGTCTATAATAATTGG + Intronic
928835553 2:35540200-35540222 TCTAGTGAGTCCATAAGCATGGG + Intergenic
930045014 2:47163258-47163280 TATAAAGAGTCTATAACAATGGG + Intronic
930778585 2:55199661-55199683 TGTAATCAGTTTATAATAATGGG + Intronic
940782303 2:157945688-157945710 AGGAGTGAGCCTATGACAATTGG + Intronic
942170616 2:173286149-173286171 CGTAGTGATTTTCTAACAATGGG - Intergenic
943062817 2:183056561-183056583 TGTAATGAGTCTATCAAAAATGG + Intergenic
1169794488 20:9446975-9446997 TGTGGTGAATCTATTACCATTGG + Intronic
1171125166 20:22596400-22596422 TTTAGTCAGTCTATTACTATTGG + Intergenic
1179320609 21:40287672-40287694 TGTGATGAGTCTATAACCACAGG + Intronic
1181179501 22:21056878-21056900 TCTTGTGTGTCTATATCAATCGG + Intronic
1184944282 22:47791457-47791479 TGCAATGAGTTTATAACATTAGG + Intergenic
950783813 3:15415627-15415649 TGTAGTGAGTGTATAGAAAGGGG - Intronic
951614572 3:24527370-24527392 TTTAGTGACTTTATAACATTTGG + Intergenic
951996754 3:28738229-28738251 TGTACTGAGTCTATATGAGTGGG + Intergenic
954773291 3:52993896-52993918 TGTAATGAGTATATAATAATTGG - Intronic
959225483 3:103577751-103577773 TGTAGTGAATCTAAAAGAAGAGG + Intergenic
960527575 3:118727367-118727389 TGTAGTGATTCTTTAAAGATTGG + Intergenic
964594732 3:158412415-158412437 TGAAGTGAGTCTTAAAGAATAGG - Intronic
972940532 4:44189852-44189874 TGTGGTGCTTCTATAAAAATAGG - Intronic
972942084 4:44208268-44208290 TTTACTGAGTCAATACCAATTGG + Intronic
977747902 4:100573357-100573379 TGTAGTGAGTCTATAACAATTGG + Intronic
978182631 4:105818459-105818481 TGTAGAGAGGCTGGAACAATGGG + Intronic
978501055 4:109410404-109410426 GGTGGTGAGTCCATAACAAAGGG + Intergenic
981146282 4:141328684-141328706 TGTAGTGAGTCAACAAAAGTAGG - Intergenic
981779088 4:148405426-148405448 TGTAGTGTGGATATAACAAGAGG - Intronic
981791559 4:148542801-148542823 TGTAGAGAATGTATGACAATAGG + Intergenic
983453867 4:167938516-167938538 TGTAGGGAGTGTAAGACAATAGG + Intergenic
984320499 4:178189899-178189921 TAGAATGAGTCTATAACCATTGG + Intergenic
987890827 5:23875122-23875144 TGTAGTGATTCAATATCAGTAGG + Intergenic
993218232 5:85053852-85053874 TTTAGTGAGTCTCAAACTATGGG - Intergenic
993236365 5:85315171-85315193 CTAAGTGATTCTATAACAATAGG + Intergenic
994650702 5:102523468-102523490 AGTAATGAGTATATAAAAATTGG + Intergenic
994718270 5:103349801-103349823 TGAAATAATTCTATAACAATTGG - Intergenic
1010378332 6:75200629-75200651 TGTACTAAGTCTTTGACAATTGG - Intronic
1018909124 6:168091833-168091855 TGTAGTGAGTCTATTAGTCTGGG - Intergenic
1020725603 7:11809919-11809941 GGTAGTGGTTCTAGAACAATGGG + Intronic
1021031170 7:15738430-15738452 TTTATTCAGTCTATTACAATAGG + Intergenic
1021290636 7:18839787-18839809 TGTAGAGAGTATAAAACCATTGG - Intronic
1028664733 7:93328410-93328432 TGTAGAGAGCCTATATAAATAGG + Intronic
1031521764 7:122776066-122776088 TATAGTTGGTATATAACAATAGG - Intronic
1031726610 7:125247583-125247605 TGCAGTGTGTTTATAAAAATTGG - Intergenic
1035358142 7:158291464-158291486 TCTAGTTAATTTATAACAATTGG - Intronic
1036397905 8:8384529-8384551 TGCAGTGAGTCAATGACAGTGGG - Intronic
1039189366 8:34954758-34954780 AGTAGAGAGTCATTAACAATAGG + Intergenic
1039801196 8:40956182-40956204 TGAAGTGAGTCTATCACTTTAGG + Intergenic
1044037971 8:87330031-87330053 TGTAGATATTCTATATCAATTGG + Intronic
1044096812 8:88076939-88076961 TGTGGTGAGATTATAGCAATGGG - Intronic
1045440960 8:102210338-102210360 TCTAGTGAGTCTATGGCTATTGG - Intronic
1046183860 8:110688053-110688075 TCTAGTCAGTCCATAAAAATTGG + Intergenic
1050438971 9:5640282-5640304 TGTCGTGAGTTTAAAATAATGGG - Intronic
1050867781 9:10525419-10525441 TGTACTGAGTATATAATGATTGG - Intronic
1055010322 9:71558659-71558681 TGTGGGGAGTCTAAAATAATAGG + Intergenic
1058127582 9:101212623-101212645 TGTTGTCAGTATATAACTATAGG + Intronic
1058254236 9:102741243-102741265 TGTAGTGAGTATATTAGTATCGG - Intergenic
1058385647 9:104431919-104431941 TGGAGTGAGTCAATGACCATGGG - Intergenic
1058567787 9:106304906-106304928 TTTATTGAGTCTTTAAAAATTGG + Intergenic
1058695579 9:107556351-107556373 TGTAGTGAGTCCATGTCCATGGG - Intergenic
1059116334 9:111603207-111603229 TCTAGTGATTCTAGAACAATAGG + Intergenic
1186639482 X:11440313-11440335 TGTAGTAAGTGCAAAACAATGGG - Intronic
1188170731 X:26921369-26921391 TTAAGTGAGTTTATCACAATGGG + Intergenic
1193410717 X:81159458-81159480 TGTAGTGCTTCTAAAACTATGGG + Intronic
1193882828 X:86945825-86945847 TGTGGTTAGTCTATACAAATTGG + Intergenic
1196509969 X:116498089-116498111 TGTCATGAGTTTAAAACAATGGG - Intergenic
1197621525 X:128755899-128755921 TGTAGTAAGTCTCTCACAACAGG - Intergenic
1199688758 X:150290258-150290280 TGTAGTGAGTGTGCAACATTTGG + Intergenic