ID: 977752203

View in Genome Browser
Species Human (GRCh38)
Location 4:100622629-100622651
Sequence TGGGACACAATTGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 785
Summary {0: 1, 1: 4, 2: 56, 3: 220, 4: 504}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977752203_977752205 -6 Left 977752203 4:100622629-100622651 CCAGTTTTTCCAATTGTGTCCCA 0: 1
1: 4
2: 56
3: 220
4: 504
Right 977752205 4:100622646-100622668 GTCCCATTGACAAAGAAAAATGG 0: 1
1: 0
2: 12
3: 45
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977752203 Original CRISPR TGGGACACAATTGGAAAAAC TGG (reversed) Intronic
900517746 1:3091108-3091130 AGAGACACAAATGGAAAGACAGG + Intronic
900615753 1:3565007-3565029 TGGGACAGAATTGGAAGGAAAGG - Intronic
901940187 1:12656077-12656099 TGGGACACATTCTTAAAAACTGG - Intronic
902971108 1:20051658-20051680 TAGGACACAATTGGAGAAACTGG + Intronic
903149994 1:21400375-21400397 TAGGACACAATTGGAGAAACTGG + Intergenic
904709698 1:32420510-32420532 CAGGACACAATTGGAAAACCTGG + Intergenic
905059605 1:35128415-35128437 CAGGACACAGTTGGAGAAACTGG - Intergenic
905428765 1:37906076-37906098 TAGGACACAGTTGGAGAAATTGG + Intronic
905579315 1:39071618-39071640 CAGGACACTATTGGAGAAACTGG - Intergenic
905681297 1:39873546-39873568 AGGGACATAAGTGAAAAAACTGG + Intronic
906100706 1:43258926-43258948 TGGGACACACTTGGAGGAACTGG - Intronic
906269604 1:44465228-44465250 TGCGACACCAGTGGAAAAGCAGG + Intronic
906377930 1:45311717-45311739 CAGGACACAATTGGAGAAACTGG + Intergenic
906563117 1:46774649-46774671 CAGGACACAAATGGAGAAACTGG + Intronic
906633697 1:47393583-47393605 TGGGACACAGTTGGAGATGCTGG - Intergenic
906687993 1:47774869-47774891 TGGGACACACCTGTACAAACAGG - Intronic
907035565 1:51213114-51213136 TAGGACACAATTGGAGACACTGG + Intergenic
907899371 1:58723472-58723494 TGGGACATAACTGAAAAAATAGG - Intergenic
908138095 1:61154027-61154049 TGGGAGACAATTTGAAAACTTGG + Intronic
908503519 1:64770668-64770690 TGGAACACTATTATAAAAACTGG - Intronic
908533562 1:65056521-65056543 TGGGACACAATGGGGAAGAAAGG - Intergenic
909064882 1:70923883-70923905 CGGGACACAATTGGAGAAACTGG + Intronic
909598429 1:77433519-77433541 TGGGATACAAGTGGAAACATTGG - Intronic
909962802 1:81868338-81868360 TGGGGAATAAATGGAAAAACAGG - Intronic
910065868 1:83150342-83150364 TGGGAAACACTTGGAAGAATTGG - Intergenic
910386992 1:86694531-86694553 CAGGACACAATTGGATAAACTGG - Intergenic
910464015 1:87477066-87477088 TGTGACAGAATTGGAACTACTGG + Intergenic
910617407 1:89214915-89214937 TGGGACACAGTTGGAGGAACTGG + Intergenic
910626712 1:89315004-89315026 CAGGACACAATTGGAAAACCTGG - Intergenic
910706733 1:90138625-90138647 TGGGTCACAATAGCTAAAACAGG + Intergenic
910794893 1:91088479-91088501 CAGGACACAATTGGAGAAATTGG + Intergenic
911907777 1:103591238-103591260 CATGACACAATTGGAGAAACTGG - Intergenic
912111384 1:106346790-106346812 CAGGACACAATTGGAATAATTGG - Intergenic
912444596 1:109725468-109725490 CAGGACACAGTTGGAGAAACTGG - Intronic
912612633 1:111063585-111063607 TATGAAACAATTGGCAAAACTGG + Intergenic
912981140 1:114374392-114374414 TAGGACACCATTGGGGAAACTGG + Intergenic
912981470 1:114377677-114377699 CAGGACACCATTGGAGAAACTGG + Intergenic
913502671 1:119485589-119485611 CAGGACACAATTGGAGAAACTGG - Intergenic
914358794 1:146911847-146911869 TGTGACAGAATTGGAACTACTGG + Intergenic
914510281 1:148326644-148326666 TGGGACACAAGTGGAGGAACTGG + Intergenic
915652746 1:157330506-157330528 CAGGACACAATTGGAGAAACTGG + Intergenic
915655742 1:157358902-157358924 CAGGACACAATTAGAAAAACTGG + Intergenic
915665792 1:157443322-157443344 CAGGACACAATTGGAAAAACGGG - Intergenic
916032371 1:160889028-160889050 TGGGACAGAAATGGCAAAGCAGG - Intergenic
916192982 1:162197272-162197294 TGGGAAACAAAGGGAAAATCTGG + Intronic
916421410 1:164641122-164641144 GAGGACACAACTGGAAGAACAGG - Intronic
916623843 1:166532052-166532074 CAGGACACAGTTGGAGAAACTGG + Intergenic
916722273 1:167493341-167493363 TGGGACAAAAGGAGAAAAACTGG - Intronic
916954421 1:169816856-169816878 CAGGACACAACTGGAGAAACTGG - Intronic
916991281 1:170248588-170248610 TGGGAAAAAATTGGAACAATCGG - Intergenic
917209661 1:172618946-172618968 CGGGATGCAATTGGAGAAACTGG + Intergenic
917310848 1:173676186-173676208 CAGGACACAATTGGAGAAACTGG - Intergenic
918589662 1:186226683-186226705 CAGGACACAATTGGAAAAACTGG + Intergenic
918633976 1:186752959-186752981 TGGGGCACATATGTAAAAACTGG + Intergenic
918999800 1:191815632-191815654 TGGGTCACATTTTCAAAAACTGG - Intergenic
919097392 1:193054488-193054510 TGTGACCAAATAGGAAAAACTGG + Intronic
919239069 1:194888412-194888434 TGGGACACAATTGAAGGAACTGG - Intergenic
919328692 1:196140873-196140895 CAGTACATAATTGGAAAAACTGG - Intergenic
920099430 1:203507749-203507771 TGGGTAACCTTTGGAAAAACAGG - Intronic
920402472 1:205684902-205684924 AGGGACATTAGTGGAAAAACTGG + Intergenic
920640377 1:207746396-207746418 CAGGACACAATTGGGAAAACTGG + Intergenic
921474108 1:215584763-215584785 CAGGACACAATTGGAGAAACTGG - Intronic
921926692 1:220716342-220716364 GAGGACACAATTGGAGAAACTGG + Intergenic
922550750 1:226492409-226492431 CAGGACACAATTGGAAAAACTGG - Intergenic
922601173 1:226855279-226855301 CAGGACACAATTGGAGAAACTGG + Intergenic
922761673 1:228136200-228136222 CAGGACACAATTGGAAATATTGG + Intergenic
923914133 1:238483401-238483423 CAGAAAACAATTGGAAAAACTGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924522812 1:244820111-244820133 CCGGACACAAGTGGAAAAGCTGG + Intergenic
1063332165 10:5170782-5170804 CAGGACACAATTGGAAAAACTGG - Intergenic
1063341148 10:5264150-5264172 CAGGACACAATTGGAGAAACTGG - Intergenic
1064175330 10:13070355-13070377 CAGCACACAATTGGAGAAACTGG + Intronic
1064637449 10:17384038-17384060 CAGGACACAATTGGAGAAACTGG + Intronic
1065004244 10:21365213-21365235 TGTGAGACAATTGGAGAAAATGG + Intergenic
1065119610 10:22515742-22515764 TGGGATAAAATAGGAAAAACTGG + Intergenic
1065393985 10:25214528-25214550 AGGGACATTAGTGGAAAAACAGG - Intronic
1065620525 10:27576409-27576431 TGGGGCAGAATTGGAATAAGTGG - Intergenic
1065943533 10:30586747-30586769 AGGGACACAACTGGAGATACTGG - Intergenic
1066083318 10:31953777-31953799 CAGGACACAATTGGAGGAACTGG - Intergenic
1067326823 10:45276507-45276529 CAGAACACAATTGGAAAAACTGG - Intergenic
1068228870 10:54143881-54143903 TGGGACACAATTGGAGGAAGTGG + Intronic
1068318732 10:55382097-55382119 TGGGTCACATTTTGAAACACTGG + Intronic
1068419079 10:56765544-56765566 TGTGACAGAGTTGGAAGAACTGG - Intergenic
1068473828 10:57500021-57500043 TAGGACACATTTGGAGACACTGG + Intergenic
1068686482 10:59875267-59875289 TTGGACAAAATTTGGAAAACAGG - Intronic
1068907342 10:62341449-62341471 CAGGACACAATTGGAAAAACTGG - Intergenic
1070251243 10:74775150-74775172 CAGGACACAATTGAAGAAACTGG - Intergenic
1070287032 10:75091572-75091594 AAGGACATAAGTGGAAAAACTGG - Intergenic
1070696491 10:78567641-78567663 AGGGACACAAATGGAGAAGCGGG + Intergenic
1070821272 10:79356137-79356159 TGTGAATCAATTGGCAAAACGGG + Intergenic
1071055109 10:81500678-81500700 TAGGACACAATTGGAGACACTGG - Intergenic
1071427651 10:85575481-85575503 TGGGCCGCAAAGGGAAAAACAGG - Intergenic
1071898442 10:90091213-90091235 CAGGACACAATAGGAGAAACTGG + Intergenic
1071926315 10:90414228-90414250 CAGAACGCAATTGGAAAAACTGG + Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1072775855 10:98192207-98192229 AGGAAAAAAATTGGAAAAACTGG + Intronic
1073738421 10:106378602-106378624 CAGGACACAATTGGAGAAATTGG + Intergenic
1074214613 10:111372305-111372327 CAGGACACAAATGGAAAAACAGG + Intergenic
1074800458 10:116995659-116995681 TAGGATACAATTGAAAATACTGG + Intronic
1075475048 10:122727260-122727282 TGACATAAAATTGGAAAAACTGG + Intergenic
1075624885 10:123955499-123955521 CAGGACACAATTGGAAGCACTGG - Intergenic
1077004710 11:348257-348279 CAGGACACAATTGGAGAAATTGG + Intergenic
1077558344 11:3238941-3238963 TGGGACACAATTGGAGACCCTGG - Intergenic
1077825369 11:5802934-5802956 AGGTACACAAGTGGAAAGACTGG + Intronic
1077873903 11:6287097-6287119 CAGGACACAATTGGAGAAATTGG + Intergenic
1077927103 11:6692630-6692652 CAAGACACAATTGGAGAAACTGG + Intergenic
1077942074 11:6853741-6853763 CAGGACACAATTGGAGAAACTGG + Intergenic
1078051718 11:7970835-7970857 CAGGACACAATTGGAGACACAGG - Intronic
1078657458 11:13255113-13255135 TGGGACTCAAATGGAGAAGCTGG + Intergenic
1078751297 11:14166197-14166219 CAGGACACAATTGGATAAACTGG - Intronic
1078953865 11:16167475-16167497 TGGGAGACCATTGGAAAGAACGG - Intronic
1079235796 11:18689218-18689240 CAGGACACAATTGGAGACACTGG + Intergenic
1079412752 11:20205330-20205352 CAGGACACAATTGGAGAAATTGG + Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080074750 11:28135618-28135640 CAGGACACAATTGGAGAAACTGG - Intronic
1080288498 11:30643842-30643864 CAGGGCACAATTGGAGAAACTGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081386810 11:42481650-42481672 TGGGAACCAAATAGAAAAACAGG - Intergenic
1082228531 11:49736970-49736992 TAAGACACAATTAGAAAAACTGG - Intergenic
1082656149 11:55859571-55859593 GCGGACACAATTGGAGAAAGTGG + Intergenic
1082942199 11:58718153-58718175 CAGGAAACAATTGGAGAAACTGG - Intronic
1082949258 11:58792859-58792881 CAGGACACAATTAGATAAACTGG - Intergenic
1082981316 11:59125493-59125515 TGGGACAATAATGGAAACACAGG + Exonic
1083001343 11:59293967-59293989 GAGGACATAATTGGAGAAACTGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083239397 11:61375693-61375715 CAGGACACAATTGGAGAAACTGG + Intergenic
1083358840 11:62090866-62090888 CAGGACACAATTGGAGAAACTGG + Intergenic
1083424645 11:62576924-62576946 TGGGACACAGTGGGCAACACAGG + Exonic
1083504321 11:63141421-63141443 AAGGATACAATTGGAGAAACTGG + Intronic
1085094137 11:73745111-73745133 TGGGAAAAAATAGGAAAAATTGG + Intronic
1085173308 11:74466751-74466773 TGGGCCACCATTTGTAAAACGGG - Intronic
1085564161 11:77498102-77498124 AAGGACACTAGTGGAAAAACAGG + Intergenic
1086058692 11:82677847-82677869 GAGGACACAATTGGAAAAACTGG - Intergenic
1086621542 11:88892178-88892200 TAAGACACAATTAGAAAAACTGG + Intronic
1087047433 11:93853875-93853897 CAGGACAAAATTGGAGAAACTGG - Intergenic
1087049724 11:93873393-93873415 CAGTACACAATTGGAGAAACTGG - Intergenic
1087146473 11:94818116-94818138 TAGGACACAATTGGAGACACTGG + Intronic
1087432074 11:98067295-98067317 CAGAACACAATTGGAGAAACTGG - Intergenic
1087971806 11:104493494-104493516 CAGGACACAATTGGGGAAACTGG + Intergenic
1088019825 11:105106084-105106106 CAGGACACAATTGGAGAAATTGG + Intergenic
1088357354 11:108957846-108957868 TGTGACAAAAGTGGGAAAACTGG + Intergenic
1088415144 11:109580395-109580417 TGAGAGACAATTGGAAATTCAGG - Intergenic
1088475541 11:110234993-110235015 TAGCACACAATTGTAAAATCAGG - Intronic
1089488596 11:118866742-118866764 CAGGACACAATTGGAGAAACTGG + Intergenic
1090100393 11:123789363-123789385 CAGGACACAGTTGGAAAAACTGG - Intergenic
1090291389 11:125548243-125548265 CAGGACACAATTGGAAAAATTGG - Intergenic
1090455717 11:126847910-126847932 CAGGACACAATTGGAGAAACTGG + Intronic
1090819879 11:130331888-130331910 TAGGACACAATTAGAGACACTGG - Intergenic
1090889087 11:130907138-130907160 TGGAACACAAGGGGAAAAAATGG - Intronic
1091057346 11:132431218-132431240 TGGGAAACAATGGGAACAAAAGG - Intronic
1091511163 12:1127787-1127809 TTGGACATAAATGGAAAAAGAGG + Intronic
1091594722 12:1869544-1869566 TGGAACTCAAGAGGAAAAACAGG - Intronic
1092574747 12:9768930-9768952 TGTATCACATTTGGAAAAACTGG - Intergenic
1093101199 12:15031222-15031244 CAGGGCACAATTGGAAAAATTGG - Intergenic
1093566560 12:20613247-20613269 TGGGCCACAAATGCAAAAAAGGG + Intronic
1093735697 12:22617945-22617967 CAGGACACAATTGGAGAAATTGG + Intergenic
1094100355 12:26755698-26755720 TAAGACACAATTGAAGAAACCGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094316527 12:29141437-29141459 CAGGACACAATTGGAGAAACTGG - Intergenic
1094382824 12:29862036-29862058 CAGGACACAATTGGAACCACTGG - Intergenic
1094431114 12:30370073-30370095 CAGGACACAATTGGAGAACCTGG - Intergenic
1094594309 12:31850627-31850649 CAGGATGCAATTGGAAAAACTGG + Intergenic
1095266296 12:40162099-40162121 CAGGACACAGTTGGAGAAACTGG - Intergenic
1095479140 12:42615943-42615965 CAGGACACAATTGGAGATACTGG - Intergenic
1095572986 12:43703767-43703789 CAGGACACAATTGGAAAAACTGG + Intergenic
1095602669 12:44031833-44031855 CAGGACACAATAGGAAAAACTGG + Intronic
1095710594 12:45284137-45284159 AGAAACACAATTGGAAAAAAGGG + Intronic
1095799235 12:46254721-46254743 CAGGACACAATTGGAGAAACTGG - Intronic
1096118324 12:49069441-49069463 GGGGTCACAATTTGAAAACCGGG - Intronic
1096564372 12:52465243-52465265 TGGGACAGAATGGGAAATGCTGG + Intergenic
1096658762 12:53108386-53108408 CAGGACATAATTGGAAAAAGTGG - Intronic
1097627764 12:62021702-62021724 TGGGACCCAACTGGTAAGACTGG - Intronic
1098315732 12:69191647-69191669 CAGGACACAATTGGAGAAACTGG + Intergenic
1098435090 12:70460280-70460302 TGGGACACAGTTGGAGGAACTGG - Intergenic
1099132335 12:78850616-78850638 TGGAACACAATAAGAAAAAAGGG - Intergenic
1099149554 12:79092306-79092328 TAGGACACAATTGGAAACATTGG - Intronic
1099535155 12:83833976-83833998 CAGGACACAATTGGAGAAAGTGG - Intergenic
1099950955 12:89303244-89303266 TGGGACACAACTGCAAATATTGG + Intergenic
1100864474 12:98842010-98842032 TGGGTCAAAATTTGAGAAACTGG - Intronic
1100930517 12:99603547-99603569 CATGACACAATTGGAAACACTGG - Intronic
1101383302 12:104233354-104233376 CAGGACACAATTGGAAAAACTGG - Intronic
1105451017 13:20500410-20500432 TGGGACACAGTTGAAGGAACTGG + Intronic
1105778479 13:23684983-23685005 CAGGATACAATTGGAAAAACTGG + Intergenic
1106472284 13:30067602-30067624 CAGGATACAATTGGAAACACTGG + Intergenic
1107291594 13:38860332-38860354 GGGGACAACATTGGAAAGACAGG + Intronic
1107519182 13:41162260-41162282 CAGGACACAATTGGAGACACAGG + Intergenic
1107935493 13:45341902-45341924 TGGGACAAAATTGGAACACATGG - Intergenic
1107971027 13:45642500-45642522 CAGGACACAATTGGAAAAACTGG + Intergenic
1107976938 13:45697638-45697660 TAGAACACAATTGGAGACACTGG - Intergenic
1108508088 13:51131303-51131325 TAGGACACAATTGGAAAAACTGG + Intergenic
1108855697 13:54790063-54790085 AGGGGCACAGTTGGAAGAACTGG - Intergenic
1109020415 13:57083702-57083724 CAGGACACGATTGGAAAAACTGG - Intergenic
1109293533 13:60502857-60502879 CAGGACACAATTAGAAAAACCGG - Intronic
1109346088 13:61116274-61116296 CAGGACATAATTGGAGAAACTGG + Intergenic
1109388993 13:61668785-61668807 CAGGACACAATTGGAGAAACTGG - Intergenic
1109866870 13:68276073-68276095 CGGGACACAATTGGAGACACTGG + Intergenic
1109867742 13:68287589-68287611 TGGAACACAAACAGAAAAACAGG + Intergenic
1110170212 13:72491354-72491376 TAGGACACAATTGTAAAATGGGG - Intergenic
1110952927 13:81518056-81518078 CAGAACACAATTGGAAAAACTGG - Intergenic
1111132745 13:83998256-83998278 CAGGACACAATTGGAGAAAGTGG + Intergenic
1111213619 13:85113850-85113872 TGAGACACAAGTTGAAAAATGGG - Intergenic
1111214352 13:85123444-85123466 AGGGACACACCTGGAAAATCGGG + Intergenic
1111799872 13:92968400-92968422 TGGGAAACACTTAGAAATACTGG + Intergenic
1112413331 13:99182492-99182514 TAGGACACAATTGGAGAAATTGG - Intergenic
1112549513 13:100406214-100406236 CAGGACACAATTGGAGAAAGTGG - Intronic
1112929964 13:104721723-104721745 CAGGACACAATTGGAGACACTGG - Intergenic
1113000014 13:105624572-105624594 TGGGAAACAATTTGATACACAGG - Intergenic
1113800691 13:113084972-113084994 GGGGACAAACCTGGAAAAACGGG - Exonic
1113898337 13:113780302-113780324 CAGGACACAATTGGAGAAACTGG - Intronic
1114504722 14:23200843-23200865 CAGGACACAATTGAAGAAACTGG - Intronic
1114553780 14:23549984-23550006 TGGGAAACAGATGGAAAAAAGGG + Intronic
1114583899 14:23791802-23791824 CAGGACACAATTGGAAAAATTGG - Intergenic
1114862174 14:26537531-26537553 TGAGAGACAATTGGCAAAAAGGG + Intronic
1115244279 14:31279205-31279227 TAGGACACAATTGGAGAAACTGG + Intergenic
1116262093 14:42643531-42643553 TGGCAAACATATGGAAAAACTGG - Intergenic
1116329839 14:43581930-43581952 CAGGACACAATTGGAGAAATTGG + Intergenic
1116390211 14:44382134-44382156 CAGGACACAATTGGAGAAAGTGG - Intergenic
1116553745 14:46276134-46276156 TGGGAAATAATTGGGAAAATAGG - Intergenic
1117187527 14:53255810-53255832 CAGGACACAATTGGAGAAACTGG - Intergenic
1117307679 14:54492346-54492368 CAGAACACAATTGGAAACACTGG - Intergenic
1117592157 14:57281746-57281768 TGGGATTCAATTGGAGCAACAGG + Intronic
1117817886 14:59617087-59617109 CAGGACACATTTGGAGAAACTGG + Intronic
1118535560 14:66759415-66759437 CAGGACACAATTAGAGAAACTGG - Intronic
1118589476 14:67390726-67390748 AGGGACACAAGAGGAAAAACTGG - Exonic
1118631493 14:67707995-67708017 CAGGACACAATTGGAGAAACTGG - Intronic
1118886860 14:69874621-69874643 TGGGACACAATTAGAAGTAGAGG - Intronic
1118938745 14:70313066-70313088 CAGGACACAATTGGAGAAACTGG + Intergenic
1118961981 14:70542305-70542327 GAGGACACAATTGGAAAAACTGG + Intergenic
1119252588 14:73169524-73169546 TGGAACACAATAAGATAAACAGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120314141 14:82870770-82870792 CAGCACACAATTGGAAAAATTGG + Intergenic
1120912976 14:89684432-89684454 TAGGACAGAATTGGAGAAACTGG + Intergenic
1121147336 14:91595749-91595771 TAGGACACAATTGGAGGAATTGG - Intronic
1121540107 14:94719289-94719311 TGGGAGACATTTGGAATAACGGG - Intergenic
1122174018 14:99902966-99902988 CAGGACACAACTGGAGAAACTGG - Intronic
1122433715 14:101677138-101677160 TAGGACACAATTGGAGAAACTGG - Intergenic
1123138551 14:106053197-106053219 CAGGACACAATTGGAGAAACTGG - Intergenic
1123766066 15:23479584-23479606 CATGACACAATTGGAGAAACTGG + Intergenic
1123768478 15:23505206-23505228 CAAGACACAATTGGAAAAACTGG - Intergenic
1123770961 15:23528193-23528215 CAGGACACAATTGGAGAAACTGG - Intergenic
1123819117 15:24009414-24009436 TGGGACACAATTGGAGATGCTGG - Intergenic
1123820434 15:24024511-24024533 CAGGACACAACTGGAAACACTGG - Intergenic
1123847751 15:24320636-24320658 TGGGACACAATTGGAGACACTGG - Intergenic
1123866792 15:24528013-24528035 TGGGACACAATTGGAGACACTGG - Intergenic
1124835240 15:33190559-33190581 TGGGGGAAAAATGGAAAAACAGG + Intronic
1124890089 15:33724880-33724902 AGGCACAGAAATGGAAAAACAGG - Intronic
1126205076 15:46036188-46036210 TGGGACACAGTGCCAAAAACAGG + Intergenic
1126430631 15:48580122-48580144 TTAGAAGCAATTGGAAAAACTGG - Intronic
1126624034 15:50668857-50668879 CAGGACACAATTGGAGAAACTGG + Intronic
1126707922 15:51423600-51423622 CAGGACACAATTGGAGAAAGTGG - Intergenic
1127027899 15:54828349-54828371 AGGGACATCAGTGGAAAAACTGG + Intergenic
1127374618 15:58372105-58372127 TAGGACACAATTGGAGACACTGG - Intronic
1128289484 15:66466210-66466232 CAGGACACAATTGGAGAAACTGG - Intronic
1128351081 15:66889354-66889376 CAGGACACAATTGGAGAAATTGG - Intergenic
1128640984 15:69337338-69337360 CAGGACACCATTGGAGAAACTGG + Exonic
1128901930 15:71430956-71430978 CAGAACACAATTGGAAACACTGG - Intronic
1129378255 15:75148592-75148614 CAGGACACAGTTGGAGAAACTGG + Intergenic
1130167606 15:81479563-81479585 TGGGTAAAAAGTGGAAAAACAGG + Intergenic
1130836731 15:87657384-87657406 CGGGACACAATTGGAGACACTGG - Intergenic
1130999531 15:88928513-88928535 CAGGACACAATTGGAGAAATTGG + Intergenic
1131873941 15:96785113-96785135 AGGGACACTATTGAAAAATCAGG - Exonic
1133999928 16:10775050-10775072 TGGCACTCACTCGGAAAAACAGG + Exonic
1134105114 16:11479806-11479828 GAGGACAGAAATGGAAAAACTGG - Intronic
1134227461 16:12402342-12402364 TGGAACACAATTTGAGACACCGG - Intronic
1135036375 16:19081303-19081325 CAGGACACAATTGGAGAAACTGG + Intergenic
1135077378 16:19405115-19405137 CAGGACACAATTGGAGAAAGTGG - Intergenic
1135325161 16:21521051-21521073 TGGGATACAATGGGAATTACTGG - Intergenic
1136336645 16:29614319-29614341 TGGGATACAATGGGAATTACTGG - Intergenic
1136352044 16:29716926-29716948 CAGGACACAGTTGGAAAAACTGG + Intergenic
1137330453 16:47489821-47489843 CAGGACACAATTGGAGAAACTGG - Intronic
1137453088 16:48595665-48595687 CAGGACACAATTGGAGAAACTGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139566531 16:67780830-67780852 TGAGACCCACTTGGAAATACTGG + Intronic
1139737058 16:68999487-68999509 TGGGACACAACTAGAGACACTGG - Intronic
1140533732 16:75690137-75690159 TGGGACACAGTTTGAGGAACTGG + Intronic
1141508116 16:84493738-84493760 CAGGACATAATTGGAAACACTGG + Intronic
1142037373 16:87870103-87870125 TGGGATACAATGGGAATTACTGG - Intergenic
1144264489 17:13555048-13555070 TGGGACACCATTGGTGAAAATGG - Intronic
1144796707 17:17896337-17896359 GGGAAGAGAATTGGAAAAACAGG + Intronic
1145226655 17:21134622-21134644 CAGGACACAATTGGAGAAACTGG - Intronic
1148632690 17:49123916-49123938 CAGGACACAATTGGAAAAACTGG - Intergenic
1148951465 17:51316867-51316889 CAGGACAGAATTGGAGAAACTGG + Intergenic
1149173326 17:53839973-53839995 CAGGACACAATTGGAGAAACTGG - Intergenic
1150464937 17:65384653-65384675 TTGAACACTATTGGAACAACTGG - Intergenic
1152213259 17:79016081-79016103 CAGGACACAATTGGAGAAATTGG + Intergenic
1153349427 18:4062252-4062274 CAGGACACAATTGGAGAAACTGG + Intronic
1153745883 18:8179141-8179163 CAGGACACAATTGGAGAAACTGG - Intronic
1153829468 18:8909112-8909134 CAGGACACAATTGGAGAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155722019 18:29027361-29027383 TGGGTTACAGATGGAAAAACAGG + Intergenic
1155784729 18:29881868-29881890 CAGGACACAATTGGAGAAAGTGG - Intergenic
1157455325 18:47823056-47823078 CAGGATACAATTGGAAACACTGG + Exonic
1157661726 18:49451301-49451323 CAGGACACAAATGGAAAAACTGG + Intronic
1158864284 18:61622964-61622986 CAGGCCACAATTGGAAAAACTGG + Intergenic
1159198521 18:65150328-65150350 GGGGACACAGTTGGACAAAGTGG - Intergenic
1159610783 18:70523448-70523470 TGGAACCTAATTGGAAAATCGGG - Intergenic
1160607400 18:80062062-80062084 CAGGACACAACTGGAGAAACTGG - Intronic
1162667491 19:12226508-12226530 CAGGACACAATTGGGAAAACTGG - Intronic
1162865890 19:13546674-13546696 TGGGATAAATTTGGAGAAACTGG - Intronic
1162962295 19:14135593-14135615 TGGGACACAAATGGGAAGATGGG + Intronic
1164035890 19:21454620-21454642 CAGGACACAATTGGAGAAACTGG - Intronic
1164885566 19:31775482-31775504 TGGGACACGAGTGGAAACAAAGG - Intergenic
1165697107 19:37908869-37908891 TGGGACACAAAGGCAAAAGCTGG - Intronic
1166167372 19:41001119-41001141 TGGCACACAACTGGGAAAAGGGG + Intronic
1166249118 19:41553839-41553861 CAGGACACAATTTGAAAAACTGG - Intronic
1166390817 19:42407866-42407888 TGGCACACAAGGGGAAAGACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166418910 19:42619087-42619109 CAGGACACAATTGGAAAAACTGG + Intronic
1166900762 19:46060092-46060114 ACAGACACAATTGGAGAAACTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168665923 19:58204739-58204761 TAGGACAAAACTGGAAGAACGGG - Intronic
924972766 2:144294-144316 CAGGACACAATTGGAAAAACTGG - Intergenic
926101184 2:10119332-10119354 TTTGAAACAATTGGAAAAACAGG + Intergenic
926114133 2:10200820-10200842 CAGGACACAATTGGAAGAACTGG - Intronic
928180120 2:29062840-29062862 TGGGACACAGTGGGTGAAACTGG - Exonic
928226140 2:29449800-29449822 TGTGACATAATTGGAGAAAGGGG + Intronic
928833785 2:35519473-35519495 CAGGATACAATTGGAGAAACTGG - Intergenic
929535497 2:42781244-42781266 CAGGACACAATTGGAGAAACTGG + Intronic
930150320 2:48052635-48052657 CAGGACACAGTTGGAAAAATTGG - Intergenic
930495017 2:52130481-52130503 CAGGACACAATTGGAGAAACTGG + Intergenic
930554594 2:52879424-52879446 TGAGATAGAATTAGAAAAACAGG + Intergenic
930954177 2:57184556-57184578 CAGGACACAATTGAAGAAACTGG + Intergenic
930979796 2:57510018-57510040 TGAGACACAACTAGAAAAATAGG + Intergenic
931437252 2:62258653-62258675 CAAAACACAATTGGAAAAACTGG - Intergenic
932059851 2:68485300-68485322 TGGGACACTCTAGGAATAACTGG - Intronic
932099625 2:68886085-68886107 TGGGCCACCATTGGAAAGACAGG + Intergenic
932196846 2:69791353-69791375 CAAAACACAATTGGAAAAACTGG - Intronic
933131144 2:78675112-78675134 CAGGACACAAATGGAGAAACAGG - Intergenic
933427473 2:82131080-82131102 CAGGACACAATTGGAGAAACTGG + Intergenic
933444804 2:82366087-82366109 TAGGACATAATTGGAGACACTGG - Intergenic
934108510 2:88718684-88718706 TGGGGCACAATTAAAGAAACTGG - Intronic
935024818 2:99266752-99266774 CAGGACACAGTTGGAGAAACTGG + Intronic
935153250 2:100459083-100459105 CAGTACACAATTGGAGAAACTGG + Intergenic
935377306 2:102412637-102412659 CAGGACACAATTGGAGAAACTGG + Intergenic
935850115 2:107209539-107209561 CAGGACACAATTGGAGACACTGG - Intergenic
935941213 2:108241245-108241267 CAGGACACAATTGGAAAAACTGG - Intergenic
935962304 2:108437740-108437762 TGGGACACAGTTGGAGGAACTGG - Intergenic
936521862 2:113216494-113216516 TGGGACACAGCTGGAACAAGGGG - Exonic
936806854 2:116344264-116344286 TTGGACACAATTCAAAAAACAGG - Intergenic
936839879 2:116756669-116756691 CAGGACACAACTGGAGAAACTGG + Intergenic
937112978 2:119381185-119381207 CAGGACACAATTGGAGAAACTGG - Intergenic
937579896 2:123472570-123472592 CAGGACACAATTGGAGAAACTGG + Intergenic
937712355 2:124992868-124992890 CAGGATACAATTGGAGAAACTGG + Intergenic
938009058 2:127813815-127813837 TGGGTCCCAATTGAACAAACTGG + Intergenic
938700469 2:133873619-133873641 CAAGACACAATTGGAGAAACTGG - Intergenic
939339525 2:140876439-140876461 TAGGACACAATTGGAGAAACTGG + Intronic
940401967 2:153257815-153257837 TAGGACACAATTGGAGGAACTGG + Intergenic
941199860 2:162495152-162495174 CAGGTCACAATTGGAGAAACTGG + Intronic
941249679 2:163146832-163146854 CAAGACACAATTGGAGAAACTGG + Intergenic
941609142 2:167638932-167638954 TGGGACAGAATTGGTAAACCAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943419883 2:187657167-187657189 GAGGACACAATTGGAAAAACTGG + Intergenic
943571736 2:189581716-189581738 AGGGACACAACTGGGATAACCGG - Intronic
943666158 2:190610596-190610618 GAGGACACAGTTGGAAAAACTGG - Intergenic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
944519837 2:200554029-200554051 CAGAACACAATTGGAAAAACTGG - Intronic
945218276 2:207458622-207458644 CAGGGCACAATTGGAAATACTGG + Intergenic
945370049 2:209005432-209005454 CAGGACACAATTGAAGAAACTGG + Intergenic
945869550 2:215212281-215212303 CAGGACACAACTGGAGAAACTGG + Intergenic
946701115 2:222415147-222415169 TAGGACACAATTAGAGCAACTGG + Intergenic
946737981 2:222773585-222773607 TGGCACAGACTTGGAAAAACTGG + Intergenic
947484520 2:230535956-230535978 TGAGACACAGTTGGAGGAACTGG + Intronic
947730873 2:232430851-232430873 TAGGATACAATTGGAAACATTGG + Intergenic
947884800 2:233559576-233559598 GGGGAGAAGATTGGAAAAACGGG - Intronic
948288649 2:236807808-236807830 TGGAAAACAATTTAAAAAACAGG + Intergenic
948817075 2:240517137-240517159 TGGGACAAAGTTGGAAGAACTGG + Intronic
949029116 2:241781000-241781022 CATGACACAATTGGAGAAACTGG - Intronic
949030109 2:241791343-241791365 CAGGACACAATTGGAGAAACTGG + Intronic
1168821974 20:780149-780171 CAGGACACAATTGGAAAAACTGG - Intergenic
1169429023 20:5519974-5519996 CAGGACACAATTGGAGACACTGG + Intergenic
1169585334 20:7076139-7076161 TTGGAAACATTTGGAAAACCTGG + Intergenic
1173111374 20:40193498-40193520 TGGACCACATTTGGAAAAACAGG - Intergenic
1174174138 20:48634481-48634503 TGGGGCACACATGGAAAAAGAGG - Intronic
1175311019 20:58011632-58011654 TGGGACCCACTTGGAAAGAAGGG + Intergenic
1176693446 21:9945392-9945414 CAGGACACAATTGAAGAAACTGG - Intergenic
1176734404 21:10530982-10531004 AGGAACACTAGTGGAAAAACGGG - Intronic
1177180840 21:17743504-17743526 CAGGACACAATTGGAAACACTGG - Intergenic
1177567652 21:22845211-22845233 CAGGACGCAATTGGAGAAACTGG - Intergenic
1178201967 21:30417635-30417657 CAGGACACCATTGGAGAAACTGG + Intronic
1178836566 21:36103437-36103459 CAGGACACAATTGAAAAAACTGG + Intergenic
1179956602 21:44743857-44743879 CAAGACACAATTGGAGAAACTGG + Intergenic
1180562145 22:16626457-16626479 AGGAACACTAGTGGAAAAACAGG - Intergenic
1180992508 22:19945446-19945468 CAGGACACAATTGGAAACACTGG - Intronic
1181446590 22:22980964-22980986 CAGGACACAATTGGAAAAACTGG + Intergenic
1181837375 22:25621997-25622019 CAGGACACAGTTGGAAAAACTGG - Intronic
1182066306 22:27433978-27434000 TGAGTCACAAATGGGAAAACAGG + Intergenic
1182880165 22:33726242-33726264 TGAGACAAAAATGGGAAAACTGG + Intronic
1183113626 22:35672379-35672401 CAGGGCACAATTGGAAAAACTGG + Intergenic
1183325627 22:37190658-37190680 CAGGACACAATTGGAGAAACTGG - Intronic
1183902263 22:41015310-41015332 TGGGACATTAGTGGAAAAATTGG - Intergenic
1184645633 22:45893199-45893221 TGAGACACAAGTGGGGAAACAGG - Intergenic
1184910457 22:47528996-47529018 CAGGACACAATTGAAAACACTGG - Intergenic
1184917784 22:47584368-47584390 CAGGACACCATTGGAGAAACTGG + Intergenic
1185007816 22:48294277-48294299 TGGGAGAAAACTGGAATAACTGG - Intergenic
949361273 3:3234593-3234615 CAGGACACAATTGGAGACACTGG + Intergenic
949812249 3:8018120-8018142 CAGGACACAATTGGAGAAACTGG - Intergenic
949997831 3:9632641-9632663 CAGGACACAATTGGGGAAACTGG - Intergenic
950205055 3:11073619-11073641 TGGGACACAGTTGGAGTAACTGG + Intergenic
950511625 3:13432131-13432153 CAGGACACAATTGGAAAAATTGG + Intergenic
950600009 3:14025780-14025802 CAGGACACAATTGGAGAAACTGG - Intronic
950919104 3:16676245-16676267 CAGGACACAATTAGAGAAACTGG + Intergenic
951297966 3:20962589-20962611 CAGGACACAGTTGGAGAAACTGG + Intergenic
951810926 3:26698904-26698926 AGGGACATTATTGGAACAACTGG - Intronic
951821964 3:26824043-26824065 CAGGACACAATTAGAGAAACTGG + Intergenic
952454389 3:33458857-33458879 GAGAACACAATTGGAGAAACTGG - Intergenic
953416361 3:42721721-42721743 CAGGACACAATTGGAGAAATTGG + Intronic
953441276 3:42919707-42919729 CAGGACACAATTGGAGAAACTGG - Intronic
953802864 3:46041222-46041244 TGGGACACAGTTGGAGGAATTGG + Intergenic
954287877 3:49631633-49631655 TGGGAGGCAGTTGGAAAAAGAGG + Intronic
954484418 3:50833770-50833792 CAGGACACAATTGGAGAAATTGG - Intronic
954597974 3:51843175-51843197 TAGGACACAATTGGAAAAAATGG - Intergenic
955007111 3:54979351-54979373 TAGGATACAACTGGAGAAACTGG - Intronic
955381056 3:58438486-58438508 CAGGACACAATTGGAGAAACTGG - Intergenic
956241082 3:67131328-67131350 GGGGACGTCATTGGAAAAACTGG - Intergenic
956882409 3:73524104-73524126 TGGGAAACATTTGGACTAACAGG + Intronic
956910119 3:73808132-73808154 TGGGAGAAAATTGCCAAAACAGG - Intergenic
957200165 3:77124268-77124290 TGGAACAAAATTTGAAAAATTGG + Intronic
957539471 3:81549396-81549418 CAGGACACAATTGGTGAAACTGG + Intronic
959503956 3:107137686-107137708 TGGAACACAATTGGAGACACTGG + Intergenic
959590773 3:108078055-108078077 TGTGACACAATATGAAAATCAGG - Intronic
959822496 3:110753115-110753137 TGGGACACAATGGAAAAATAGGG - Intergenic
960152085 3:114260140-114260162 CAGGACACAATTGAAGAAACTGG - Intergenic
960228088 3:115191078-115191100 CAGGACACTATTGGAGAAACTGG + Intergenic
960654522 3:119988464-119988486 CAGGACAGAATTGGAAAAACTGG + Intronic
961334929 3:126169408-126169430 CAGAATACAATTGGAAAAACTGG + Intronic
961421684 3:126810841-126810863 TGGGACACAAGAGGAAGAACAGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962322738 3:134405431-134405453 TTGGACAGAACTGGAAAAACGGG - Intergenic
962403240 3:135079366-135079388 TGGGCCTCAATTGGATAAACGGG - Intronic
963018198 3:140845655-140845677 TGGGAAATAAATAGAAAAACAGG + Intergenic
963355220 3:144202787-144202809 AAGGACACAATTGGAGACACTGG - Intergenic
963813386 3:149802826-149802848 TGGGAGACAATTTGAATAATGGG - Intronic
964022935 3:152036062-152036084 CAGGACACAATGGGAGAAACTGG - Intergenic
964145099 3:153450743-153450765 TGGTACACAAGTGGAAAAATAGG - Intergenic
964856131 3:161147831-161147853 GAGGACACAATTGGAGACACTGG + Intronic
965027952 3:163327145-163327167 TGGAACAGAATTGGAGAAAGTGG + Intergenic
966688094 3:182717504-182717526 CAGGACACAATTGGAAAAACTGG - Intergenic
966721477 3:183067047-183067069 TGGGACACAACTGGAGAAACTGG + Intronic
966848646 3:184150277-184150299 TGGGACCCAACTGGTAAGACTGG + Intronic
966935004 3:184700833-184700855 CAGGACACAATTGGAGAAATTGG - Intergenic
967341051 3:188398399-188398421 TGAGAGACATTTGGAAAAACTGG - Intronic
968043621 3:195610555-195610577 CAGGACACAATTGGAGAAACTGG + Intergenic
968294647 3:197566208-197566230 CAGGACACAATTGGAGAAACTGG + Intronic
968301079 3:197615471-197615493 CAGGACACAATTGAAGAAACTGG - Intergenic
968345945 3:198008282-198008304 TCTGACACATTTTGAAAAACAGG + Intronic
969316367 4:6383559-6383581 TGGGGCAGAATTGGAAGAATAGG - Intronic
969634878 4:8362526-8362548 CAGGAGACAATTGGAAAAACTGG + Intergenic
969666878 4:8563257-8563279 CAGGACACAATTGGAGACACTGG - Intronic
970374457 4:15442558-15442580 TGGTACACAATGGGCAATACCGG + Exonic
970619616 4:17803827-17803849 GGGGACACAATGGGAACAATGGG + Exonic
970711889 4:18873403-18873425 CAGGACACAATTGGAGAAATTGG - Intergenic
971006572 4:22381123-22381145 CCGGACACAATTGGAGAAATTGG + Intronic
971064470 4:23014527-23014549 TGGGACACCATTGGAGACAAGGG + Intergenic
971540700 4:27813264-27813286 CAGAACTCAATTGGAAAAACTGG + Intergenic
971693092 4:29863601-29863623 CAGGACACAATTGGATAAGCTGG + Intergenic
971814001 4:31463455-31463477 CAGGACACCATTGGAGAAACTGG - Intergenic
971841336 4:31856166-31856188 TGGGACACACCTGAAACAACAGG + Intergenic
971886399 4:32455235-32455257 CAGAACACAGTTGGAAAAACTGG + Intergenic
971913305 4:32824713-32824735 CAGGACACAATTGGAGAAACTGG - Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
971969016 4:33598135-33598157 TAAGACACAATAGGCAAAACTGG + Intergenic
972817424 4:42659030-42659052 TGGGACACACATGTAAAAAATGG - Intergenic
974203878 4:58674476-58674498 CAGGACACGATTGGAGAAACTGG + Intergenic
974295707 4:59995959-59995981 CAAGACACAATTAGAAAAACTGG - Intergenic
974298618 4:60036175-60036197 TGGTTAATAATTGGAAAAACAGG + Intergenic
974674969 4:65077726-65077748 CAGAACACAGTTGGAAAAACTGG + Intergenic
974721369 4:65743286-65743308 GAGGACACAATTGGAAAAACTGG + Intergenic
974929017 4:68339407-68339429 TTGGACATAATTGGAAAAACTGG + Intronic
975528210 4:75374151-75374173 CAGGACACAATTGGAGAAACTGG + Intergenic
975614397 4:76231963-76231985 CGGGACACAATTGGAAAAACTGG - Intronic
975730341 4:77331690-77331712 CAGGACACAATTGGAAAAACTGG - Intronic
976345145 4:83992029-83992051 CAGGACACAATTGGAGAAACTGG + Intergenic
976643853 4:87367165-87367187 TGGGACACTATTGGAGAAATTGG + Intronic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
977042559 4:92032227-92032249 CAGGACACAGTTGGAGAAACTGG - Intergenic
977063625 4:92287008-92287030 CAGGAAACAATAGGAAAAACAGG - Intergenic
977379920 4:96259413-96259435 TGGTACACACTAGGAAAAAGAGG + Intergenic
977500117 4:97827705-97827727 CAGGACACAATTGGAGAAACTGG + Intronic
977513380 4:97990452-97990474 TTGGTCACAATTTGGAAAACAGG - Intronic
977527469 4:98162706-98162728 CAGGACACAATTGGAGAAACTGG + Intergenic
977590096 4:98816815-98816837 CAGGACACAATTGGAGAAACGGG + Intergenic
977752203 4:100622629-100622651 TGGGACACAATTGGAAAAACTGG - Intronic
978328792 4:107588578-107588600 CAGAACACAATTGGAGAAACTGG - Intergenic
978357011 4:107886807-107886829 CAGGACACAACTGGAGAAACTGG - Intronic
979024097 4:115545586-115545608 CAGGACACAATTGGAGAAACGGG - Intergenic
980269752 4:130568726-130568748 CAGTACACAATTGGAAAAACTGG - Intergenic
980292309 4:130859322-130859344 TGGGAGACAATTTGAATCACAGG + Intergenic
980612459 4:135177301-135177323 TAGGACACAGTTGGAGACACTGG + Intergenic
980987827 4:139712854-139712876 CAGGACACAATTGGAGAAATGGG - Intronic
981292728 4:143095417-143095439 CAGGACACAATTGGAGAAACTGG + Intergenic
981525853 4:145706606-145706628 CAGGACACAATTGGAGAAACTGG - Intronic
982131701 4:152234484-152234506 TGGCACACAATTCAAAAATCAGG - Intergenic
982475797 4:155849065-155849087 CAGGACACAATTGGAGAAACTGG + Intronic
982696612 4:158609515-158609537 GGGGACATAAATGGAAATACAGG - Intronic
983321430 4:166201122-166201144 TAGGACACAATTGGAAAAACTGG + Intergenic
983773658 4:171579519-171579541 CAGGATGCAATTGGAAAAACTGG - Intergenic
983886952 4:172990183-172990205 CAGGACACAATTGGAGACACTGG - Intronic
984066196 4:175050512-175050534 TAGGACACATTTGGAAACACTGG - Intergenic
984985584 4:185325965-185325987 CAGGACACAACTGGAAAAACTGG - Intronic
985226978 4:187771828-187771850 TGGGACACAATTGAAGAAACTGG - Intergenic
985560024 5:580505-580527 TGCTACAGAATTAGAAAAACAGG + Intergenic
985915246 5:2913266-2913288 GGGGACACAATTTGTAAACCTGG - Intergenic
986146848 5:5086031-5086053 CAGGACACAATTAGAAACACTGG + Intergenic
986213317 5:5694694-5694716 TGGGCAAAAATGGGAAAAACTGG - Intergenic
987314455 5:16711269-16711291 TGGGATACCATTAGAAAAAATGG + Intronic
987678506 5:21106404-21106426 CAGGTCACAATTGGAGAAACTGG - Intergenic
988287676 5:29241305-29241327 CAGGACAAAATTGGAAACACTGG - Intergenic
988417806 5:30968239-30968261 TAGGACACAATTGGAGACACTGG - Intergenic
988457666 5:31401112-31401134 TGGGACACAGATGGAAAAACAGG + Exonic
988773880 5:34458056-34458078 CAGGATACAATTGGAGAAACTGG - Intergenic
988831634 5:34993190-34993212 TGAGACACAATCGGTAAAAATGG - Intergenic
988899863 5:35720068-35720090 CAGGACACAATTGGAGAAAGTGG - Intronic
989017070 5:36949754-36949776 TGGGACAGATTTGGAATAAAAGG - Intronic
989755348 5:44946109-44946131 TGGGGCACAATTGAGGAAACTGG - Intergenic
991265024 5:64707536-64707558 CAGGACACAATTGGAGAAACTGG - Intronic
991423678 5:66467519-66467541 CAGGGCACAATTGGAGAAACTGG - Intergenic
991520172 5:67488197-67488219 TAGGACACAATAATAAAAACTGG + Intergenic
992292869 5:75298234-75298256 CAGGACACAATTAGAGAAACTGG + Intergenic
992506669 5:77394008-77394030 CAGGACACAATTGGAAACACTGG - Intronic
992546928 5:77822373-77822395 TGGGACCCAAATGGCAAAAAGGG + Intronic
993600613 5:89919200-89919222 GAGGACACAATTGGAGAAACTGG - Intergenic
993819012 5:92590735-92590757 GGGGACACACTTTGAAAAAATGG + Intergenic
993939652 5:94043499-94043521 CAGGACACAACTGGAAAAACTGG + Intronic
995393702 5:111665365-111665387 CAGGACACAGTTGGAAAAACTGG - Intronic
996022785 5:118610211-118610233 TGGGTCACAATTGCTACAACTGG + Intergenic
996057370 5:118996159-118996181 CGGGACACAATTGGAGACACTGG - Intergenic
996476341 5:123926300-123926322 CAGGACACAATTAGAAAAACTGG - Intergenic
997284132 5:132666329-132666351 TGGAACAAAATTGACAAAACTGG - Intergenic
998345444 5:141458006-141458028 CAGAACACAATTGGAAAAACCGG - Intronic
999008036 5:148004314-148004336 CAGGACACAATTAGAAAAACTGG + Intergenic
999482278 5:151959663-151959685 TGGGATACACTTGGAAATATGGG + Intergenic
999739485 5:154539240-154539262 TGGGACTCAATTGGAAAGAATGG - Intergenic
1000061222 5:157657848-157657870 CAGGACACAATTGGAAACAGTGG + Intronic
1000069690 5:157728335-157728357 CAGGACACAGTTGGAAAAACTGG - Intergenic
1000741042 5:164970209-164970231 CAGGACACAATTTGAGAAACTGG - Intergenic
1001358418 5:171055853-171055875 CAGGACACAACTGGAGAAACTGG - Intronic
1002030514 5:176425431-176425453 CAGGACACAATTGGAGAAACTGG - Intergenic
1002682492 5:180978214-180978236 CAGAACACAATTGGAGAAACTGG - Intergenic
1003073320 6:2961533-2961555 AGAGAAACAATTGGTAAAACAGG + Intronic
1003083304 6:3039942-3039964 CAGGACACAATTGGAGACACTGG + Intergenic
1003313537 6:4990308-4990330 TAGGACTCAATTTGATAAACTGG + Intergenic
1003374691 6:5565006-5565028 CAGGACACAACTGGAAAAACTGG - Intronic
1004113446 6:12744267-12744289 CAGGACACAATTGGAGAAACTGG - Intronic
1004646135 6:17562591-17562613 TAGGACACAATTGGAGAAACTGG - Intergenic
1005119560 6:22374995-22375017 CAGGACACAATTGGAAAAACTGG + Intergenic
1005181275 6:23109632-23109654 CAGGATGCAATTGGAAAAACTGG - Intergenic
1005573319 6:27167960-27167982 TAGGACATAATTGGAAACACTGG + Intergenic
1006080212 6:31560699-31560721 TGGGATTCAATTGGAGGAACAGG + Intergenic
1006184949 6:32176159-32176181 TGGGAGACGATTGGCAAAACAGG - Intronic
1006746549 6:36346829-36346851 TGTGACCCGATTGGAAAAAAAGG + Intergenic
1007896579 6:45367533-45367555 TGGGACAAAATGCGAAAAAAAGG + Intronic
1008144571 6:47875919-47875941 TGGCACACAATGGGAAGAAAAGG + Intergenic
1008427375 6:51375263-51375285 TGGGATGCAATTGGATAAAATGG + Intergenic
1008650941 6:53561948-53561970 CAGGACACAATTGGAGAAACTGG + Intronic
1009632038 6:66212678-66212700 TGGGATGCAATTGGAGAAACTGG + Intergenic
1009657352 6:66563967-66563989 CAGGACATGATTGGAAAAACTGG - Intergenic
1009726901 6:67546783-67546805 AAGGACACAATTGGAGATACTGG + Intergenic
1009908064 6:69892863-69892885 CAGGACACAATTGGAGAAAGTGG - Intronic
1010453460 6:76028989-76029011 CAAGACACAATTGGAAAAATTGG + Intronic
1010541506 6:77097953-77097975 CAGGGCACAATTGGAGAAACTGG + Intergenic
1010641532 6:78334401-78334423 TGGGAGACAATTACAAAGACGGG - Intergenic
1010722222 6:79296409-79296431 TGGAACACAACTGGAAATACTGG - Intergenic
1010746789 6:79572098-79572120 AAGGACACTAGTGGAAAAACTGG - Intergenic
1010810702 6:80295593-80295615 CAGGACACAATTGGAGAAACTGG - Intronic
1011292799 6:85793951-85793973 TGGGACACAATTTGAGACACTGG - Intergenic
1011590942 6:88970375-88970397 CAGGACACAGTTGGAGAAACTGG + Intergenic
1011940037 6:92831845-92831867 CAGGACACAATTGGAGTAACTGG + Intergenic
1012594794 6:101026990-101027012 CAGGACACAATTGGAGAAACTGG + Intergenic
1012694025 6:102354907-102354929 CAGGACACACTTGGAGAAACTGG - Intergenic
1012713328 6:102636708-102636730 TGGGACACAATTAGAGAAACTGG + Intergenic
1013054057 6:106565926-106565948 TGTGACTCAATTGGAAAAAATGG + Intronic
1013225006 6:108114401-108114423 TGAAACACAATTTTAAAAACAGG - Intronic
1013247723 6:108302737-108302759 CAGGGCACAATTGGAGAAACTGG - Intronic
1013546475 6:111162569-111162591 CAGGACACAACTGGAGAAACTGG - Intronic
1014961361 6:127689408-127689430 CAGGACAGAATTGGAAATACCGG - Intergenic
1015071340 6:129097070-129097092 TGGGGCACAATTGGGAGGACAGG - Intronic
1015090548 6:129352141-129352163 TGGGACACTATATTAAAAACAGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016003664 6:139067651-139067673 TGAAACACACTTGCAAAAACAGG - Intergenic
1016162208 6:140895709-140895731 CAGGACACAATTGGAAAAAATGG - Intergenic
1016205939 6:141468235-141468257 CAGGACACAATTGGAGAAACTGG - Intergenic
1016297006 6:142584195-142584217 CAAGACACAATTGGAGAAACTGG + Intergenic
1017263969 6:152420984-152421006 CAGGACACAATTGGAAACATTGG + Intronic
1017343607 6:153355198-153355220 CAGGACACAGTTGGAAAAAATGG + Intergenic
1017386182 6:153886400-153886422 CAGGACACAATTGGAGAAAATGG - Intergenic
1017727863 6:157288002-157288024 TGGGAGACACTTGGAAAGACAGG + Intergenic
1017887818 6:158613695-158613717 CAGAACACAATTGGAGAAACTGG - Intronic
1018078337 6:160236575-160236597 CAGGACACAGTTGGAGAAACTGG + Intronic
1018138164 6:160798954-160798976 CAGGACAAAATTGGAGAAACTGG + Intergenic
1018145883 6:160888254-160888276 CAGGACATAATTGGAGAAACTGG + Intergenic
1018357380 6:163031984-163032006 CATGACACAATTGGAGAAACTGG - Intronic
1018592285 6:165440371-165440393 TGGGATACAATTGGGAAAAATGG - Intronic
1019123076 6:169820586-169820608 CAGGACACAATTGAAGAAACTGG + Intergenic
1019233565 6:170588883-170588905 CAGGACACAATTGGGGAAACTGG - Intergenic
1019912956 7:4112544-4112566 TGGGACAGAATTGGAATATCAGG - Intronic
1020350364 7:7212387-7212409 CAGGACACAATTGGAAAAACTGG - Intronic
1021512811 7:21452614-21452636 CAGGACACAATTGGAGAAACTGG - Intronic
1021857661 7:24873263-24873285 TGGGACACAAGTGGTCTAACAGG + Intronic
1022579914 7:31540970-31540992 CAGGGCACAACTGGAAAAACTGG - Intronic
1022779980 7:33570985-33571007 AGGGACATTAGTGGAAAAACTGG + Intronic
1023012897 7:35939366-35939388 TGGGAAACAATTGGCACCACTGG + Intergenic
1023588411 7:41755154-41755176 CAGGACACAATTGGAGAAATTGG - Intergenic
1023782263 7:43668033-43668055 CAGGACACAATTGGTAAAACTGG + Intronic
1023933255 7:44720024-44720046 CAGGACACGATTGGAGAAACTGG - Intergenic
1024013319 7:45289254-45289276 CAGGACACAATTGGAGAAACTGG + Intergenic
1024078235 7:45834487-45834509 TGGGAAACAATTGGCACCACTGG - Intergenic
1024464437 7:49696725-49696747 TGGGCCACAATTGGGAAAGAAGG - Intergenic
1024879485 7:54069378-54069400 AGGGACATCAGTGGAAAAACTGG + Intergenic
1024906576 7:54389016-54389038 GAGGACACAATTGAAAAAACTGG - Intergenic
1024927314 7:54631029-54631051 CAGGACACAACTGGAGAAACTGG + Intergenic
1024928913 7:54649025-54649047 TTGGACACTATTGGCAAAAATGG - Intergenic
1025029606 7:55546463-55546485 AGGGACATTAATGGAAAAACTGG + Intronic
1025039162 7:55624638-55624660 CAGGACACAATTGGAGAAACTGG - Intergenic
1025157635 7:56623681-56623703 CAGGACACAATTGGAGAAACTGG + Intergenic
1025769073 7:64487144-64487166 CAGGACACAATTGGAGAAACTGG + Intergenic
1025797054 7:64747823-64747845 CAGGACACAATTGGCAAACCTGG - Intergenic
1027278236 7:76584416-76584438 TGGGAAACACTTGGAAGAATTGG + Intergenic
1027519436 7:79186134-79186156 TGGGAAACAAATGGTAAAAATGG - Intronic
1028146407 7:87324453-87324475 GAGGACACAATTGGAGAAACTGG - Intergenic
1028648814 7:93127742-93127764 CAGGACACAATTGGAGAAACTGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030155718 7:106452386-106452408 CAGGACACAATTGGAGAAACTGG - Intergenic
1030156078 7:106457103-106457125 CAGGACACAACTGGAGAAACTGG - Intergenic
1031227313 7:119055956-119055978 CAGGACACAATTGAAGAAACTGG - Intergenic
1031257954 7:119481141-119481163 TAGGACGCAATTGGGAAACCAGG - Intergenic
1032088795 7:128899774-128899796 CAGGTCACAATTGGAGAAACTGG + Intronic
1032663062 7:134007055-134007077 TAAGACACAATTAGAAAAAAGGG - Intronic
1032671628 7:134088251-134088273 CAGGACATAATTGGAAAAACTGG - Intergenic
1033161846 7:139004669-139004691 TAGGACACAATTGGAAAAATTGG + Intergenic
1033430497 7:141285095-141285117 AGGGACATTAGTGGAAAAACTGG - Intronic
1033578229 7:142707366-142707388 CAAGACACAATTGGAGAAACTGG + Intergenic
1033733133 7:144197403-144197425 TGGGAAACTATAGGAAAAATTGG + Intergenic
1033743986 7:144295969-144295991 TGGGAAACTATAGGAAAAATTGG + Intergenic
1033749915 7:144353585-144353607 TGGGAAACTATAGGAAAAATTGG - Intergenic
1033865934 7:145690690-145690712 CAGGACACAATTGGAGAAACTGG + Intergenic
1034437286 7:151069179-151069201 TGGGAAACAATTCTAAAAGCCGG - Intronic
1036793780 8:11741039-11741061 TGGGATACCATTTTAAAAACAGG - Intronic
1036960079 8:13235169-13235191 TGGGAGGCAATTGAAAGAACAGG + Intronic
1037325536 8:17685373-17685395 TCAAACAGAATTGGAAAAACAGG + Intronic
1037612767 8:20490353-20490375 TGGAACACAGTTGGATAAAGGGG - Intergenic
1037955488 8:23054529-23054551 CAGGACACAATTGGAAAAACTGG + Intronic
1037973869 8:23195528-23195550 TGGAACACAGTTGGATAAAATGG + Intronic
1039080367 8:33728190-33728212 TGGGTGACAATTGGAGAAGCTGG - Intergenic
1039439550 8:37585210-37585232 TTGGAAACAATTGGAATAAATGG + Intergenic
1039621995 8:39006207-39006229 CAGGACACAACTGGAGAAACTGG - Intronic
1039849388 8:41349604-41349626 CAGGACACAATTGGAAACACTGG - Intergenic
1039863641 8:41481557-41481579 GAGGACACAAATGGAAGAACAGG + Intergenic
1040064785 8:43136989-43137011 CAAGACGCAATTGGAAAAACTGG + Intergenic
1040374249 8:46807760-46807782 CAGGACACAATTGGAGAAACTGG - Intergenic
1040522029 8:48185904-48185926 TGAGAAAAAATAGGAAAAACAGG - Intergenic
1040526648 8:48231570-48231592 GAGGACACAATTGTAAAAACTGG + Intergenic
1040758244 8:50807114-50807136 CAGGACTCAATTGGTAAAACTGG + Intergenic
1040774946 8:51031034-51031056 TGGAATAAAATTGGTAAAACTGG - Intergenic
1040990585 8:53345879-53345901 CAGGACACAATTGAAAAAGCTGG + Intergenic
1041225221 8:55690932-55690954 TGGAACACAGTTGGAAGAGCTGG - Intergenic
1041393708 8:57371128-57371150 CAGGACACAATTAGATAAACTGG + Intergenic
1041607379 8:59798802-59798824 TTGAACACAGTTGGAAAAATTGG + Intergenic
1041810184 8:61899908-61899930 TAGGACACAATTCAAGAAACTGG - Intergenic
1042343790 8:67707546-67707568 TAGGACACAATTAGAGAAACTGG + Intronic
1042415275 8:68511072-68511094 CAGGACACAATTGGAGAAAGTGG - Intronic
1042623269 8:70729142-70729164 CTGGACACAATTGGAGAAACTGG - Intronic
1043706185 8:83353584-83353606 CAGGACACAGTTGGAGAAACTGG - Intergenic
1043924317 8:86020076-86020098 TGGGATACAGTTGGAAGAACTGG + Intronic
1044001430 8:86886149-86886171 TTGAACACCATTAGAAAAACAGG + Intronic
1044378300 8:91502111-91502133 CAGGACACAATTGGAAAAACTGG - Intergenic
1044439367 8:92205343-92205365 CAGGACACAATTGGAGAAACCGG - Intergenic
1045428470 8:102090831-102090853 GAGGACACAATTGGAGAAACTGG + Intronic
1045956856 8:107918367-107918389 TGGGACACCATTGGAGAAACTGG + Intronic
1047288749 8:123510662-123510684 AGGAACACAATTGGAAAACATGG - Intronic
1047310848 8:123690534-123690556 TGGGACACAATCTGAAACAATGG + Intronic
1047670799 8:127143907-127143929 TGAGACACAGTTGGAGGAACTGG - Intergenic
1048172716 8:132123050-132123072 AGGGACACCTTTGGTAAAACTGG + Exonic
1049448533 8:142643772-142643794 GAGGACACACTTGGAGAAACTGG - Intergenic
1050125154 9:2348990-2349012 TGAGCCACAGCTGGAAAAACTGG - Intergenic
1050923159 9:11231181-11231203 CAGTACACAATTGGAAAAACTGG - Intergenic
1051890707 9:21939912-21939934 CAGGACACAATTAGAAACACTGG + Intronic
1052521430 9:29552965-29552987 CAGGACACAATTGGAAAAGTTGG + Intergenic
1052743868 9:32420624-32420646 TGGGACATTACTGAAAAAACTGG - Intronic
1053630408 9:39931472-39931494 CAGGACACAATTGAAGAAACTGG - Intergenic
1053775362 9:41532036-41532058 CAGGACACAATTGAAGAAACTGG + Intergenic
1054213479 9:62319230-62319252 CAGGACACAATTGAAGAAACTGG + Intergenic
1054933256 9:70659144-70659166 TAGGACACAACTGGAGAACCTGG + Intronic
1055150095 9:72986680-72986702 TGGGACATATTTTGAAAACCAGG + Intronic
1056728060 9:89139778-89139800 TAGGACAGAATTGGAGAAACTGG - Intronic
1056745861 9:89301972-89301994 CAGAACACAATTGGAAAACCTGG + Intergenic
1057229535 9:93311560-93311582 TGGCACAGATGTGGAAAAACTGG - Intronic
1057236098 9:93362319-93362341 CAGGACACAATTGGAGAAACCGG + Intergenic
1057347849 9:94267407-94267429 CAGGACACAATTGGAAAAACTGG - Intronic
1057467208 9:95325161-95325183 CAGGACACAATTTGAGAAACTGG - Intergenic
1057593089 9:96390935-96390957 TGGGACACAATTAGAAATAATGG + Intronic
1058294794 9:103293094-103293116 CCGGACACAATTGGAGACACTGG + Intergenic
1058352554 9:104043077-104043099 TGGGATAGAATTAGAGAAACGGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058384189 9:104414483-104414505 CAGGACACAATTGGAGAAACTGG + Intergenic
1058997259 9:110312318-110312340 CAGGACACAATTGGAGAAACCGG + Intronic
1061830303 9:133288036-133288058 CAGGACACAATGGGAGAAACTGG - Intergenic
1203367556 Un_KI270442v1:271959-271981 TGGGAGACAATTGGAATCATGGG - Intergenic
1185951852 X:4446067-4446089 TGGGCCATAATTGGAAAAAGGGG + Intergenic
1186428164 X:9481525-9481547 CAGGACACAATTGGAGACACTGG + Intronic
1187139722 X:16581954-16581976 TCAGACACAATTGGAGAAACTGG + Intergenic
1187616426 X:20999549-20999571 CAGGACACAATTGGAGAAATTGG + Intergenic
1188113775 X:26220608-26220630 TAGGACACACTAGGAAACACCGG - Intergenic
1188133846 X:26470290-26470312 CAGGACACAATTGGAGAAATTGG - Intergenic
1188159236 X:26779893-26779915 TAGGACACAATTGGAGGAACTGG - Intergenic
1188167675 X:26881646-26881668 CAGGACACAATTGGAAAAATTGG - Intergenic
1188285332 X:28320146-28320168 CAGGACACAATTGGATATACTGG + Intergenic
1188858715 X:35230359-35230381 TGGGACACAGTTGGAGGAACTGG + Intergenic
1189153191 X:38728773-38728795 CAGGACACAATTGGAGAAAATGG + Intergenic
1189616684 X:42791017-42791039 CAGGACACAATTGTAGAAACTGG - Intergenic
1189632607 X:42970772-42970794 AAGGACACAATTGGAGAAACTGG - Intergenic
1189835557 X:45017775-45017797 AGGAATACACTTGGAAAAACTGG + Intronic
1189909980 X:45800963-45800985 AAGGACATAAGTGGAAAAACTGG + Intergenic
1190723018 X:53166728-53166750 CGGGACACAATTGGAAAAACTGG + Intergenic
1190956832 X:55203374-55203396 CAGGACACAATTGGAGACACTGG - Intronic
1191069687 X:56386732-56386754 CAAGACACAATTGGAGAAACTGG - Intergenic
1191120969 X:56904697-56904719 TGGGACACAATTGGATAAAATGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191822981 X:65333288-65333310 CAGGACACAGTTGGAGAAACTGG - Intergenic
1191865808 X:65702780-65702802 TGGGACATAACTGGAGAAAATGG + Intronic
1191912875 X:66170277-66170299 TGCTACACCATTGAAAAAACTGG + Intronic
1192323296 X:70109942-70109964 TAGGACACAATTGGAGACACTGG - Intergenic
1192542419 X:71985431-71985453 CAGGACACAATTTGAGAAACTGG - Intergenic
1192623187 X:72701131-72701153 CGGGACACAGTTGGAGAAACTGG + Intronic
1192765510 X:74136052-74136074 CAGGACACAATTGGAAAATCTGG + Intergenic
1192777279 X:74258444-74258466 CAGGACACAATTGGAAAAACTGG + Intergenic
1192864897 X:75120649-75120671 CAGGACACAATTGGAGAAACTGG + Intronic
1193330921 X:80234571-80234593 CAGGACACAACTGGAGAAACTGG - Intergenic
1193531901 X:82664629-82664651 GAGGACACAATTGGAGAAACTGG - Intergenic
1193705352 X:84814317-84814339 CAGGACACAATTGGAAAAACTGG - Intergenic
1193833781 X:86318007-86318029 CAGGACACAATTGGAAAAACTGG - Intronic
1194044777 X:88988893-88988915 CAGGACACAATTGGAAACACTGG + Intergenic
1194045559 X:88997494-88997516 CAGGACACAATTGGAAACACTGG + Intergenic
1194101415 X:89710274-89710296 CAGGACACAATTGAAAACACTGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194158338 X:90420446-90420468 CAGGACACAATTGGATAAACTGG - Intergenic
1194166943 X:90528849-90528871 CAGGCCACAATTGGAAAAACTGG + Intergenic
1194411837 X:93566931-93566953 TAGGATACAATTGGAGAAACTGG - Intergenic
1194436119 X:93870077-93870099 CAAAACACAATTGGAAAAACTGG - Intergenic
1195004767 X:100674898-100674920 TAGGAAACAATAGCAAAAACAGG + Exonic
1195048326 X:101075036-101075058 CAGGACACAATTGGAGAAATTGG + Intergenic
1195150595 X:102065665-102065687 CAGGACACTATTGGAGAAACTGG + Intergenic
1195225659 X:102789900-102789922 CAGGACACAATTGAAGAAACTGG - Intergenic
1195337210 X:103867257-103867279 CAGGACACAATTTTAAAAACTGG - Intergenic
1195487165 X:105422461-105422483 CAGGACGCAATTGGAGAAACTGG - Intronic
1195910858 X:109887250-109887272 TGGGACAGAATGGGGAAAATTGG - Intergenic
1196074227 X:111557045-111557067 CAGGACACAATTGGAAAAACTGG - Intergenic
1196162079 X:112496368-112496390 CAGGACACAATTGGAGAAACTGG - Intergenic
1196245285 X:113392193-113392215 GGGGACACACGTGGAAAAACTGG + Intergenic
1196520506 X:116665528-116665550 TAGGATGCAATTGGAAAAACTGG - Intergenic
1196543134 X:116932856-116932878 CAGGACACAATTGGAGACACTGG - Intergenic
1196773035 X:119314835-119314857 CAGGACACAATTTGAGAAACTGG + Intergenic
1197043065 X:121963663-121963685 CAGGACACAATGGGAGAAACTGG + Intergenic
1197065631 X:122230828-122230850 CAGGACACAATTGGAGGAACTGG + Intergenic
1197097064 X:122609512-122609534 AGGGACACAACTAGTAAAACAGG - Intergenic
1198090925 X:133329110-133329132 GAGGACACAGTGGGAAAAACAGG + Intronic
1198181690 X:134216206-134216228 CAGGACACAATTGGAGAAACTGG - Intergenic
1198855678 X:141013393-141013415 CGGGACACGATTGGAAAAACTGG + Intergenic
1198876453 X:141232746-141232768 CGGGACACGATTGGAAAAACTGG - Intergenic
1198907016 X:141573975-141573997 CGGGACACGATTGGAAAAACTGG - Intergenic
1198909779 X:141600483-141600505 CGGGACACGATTGGAAAAACTGG + Intronic
1198917307 X:141687656-141687678 CGGGACACGATTGGAAAAACTGG - Intronic
1199185948 X:144914935-144914957 CAGGACACAATTGGAGATACTGG - Intergenic
1199251482 X:145667593-145667615 CAGGACACAATTGGAGACACTGG + Intergenic
1199442306 X:147882682-147882704 CAGGACACAATTGAAAACACTGG + Intergenic
1199777421 X:151026977-151026999 TGAGACACAAATGCAGAAACAGG - Intergenic
1199869534 X:151885737-151885759 CAGGGCACAATTGGAGAAACTGG + Intergenic
1199887278 X:152032720-152032742 CAGGACACAATTGGAGAAACTGG - Intergenic
1199948287 X:152684657-152684679 CAAGACACAATTGGAGAAACTGG + Intergenic
1199961392 X:152783797-152783819 CAAGACACAATTGGAGAAACTGG - Intergenic
1200285150 X:154814107-154814129 CAGGACACAATTGGAGACACTGG - Intronic
1200454366 Y:3371358-3371380 CAGGACACAATTGAAAACACTGG + Intergenic
1200504660 Y:3997410-3997432 CAGGACACAATTGGATAAACTGG - Intergenic
1200513210 Y:4106625-4106647 CAGGCCACAATTGGAAAAACTGG + Intergenic
1200877637 Y:8175160-8175182 CAAAACACAATTGGAAAAACTGG - Intergenic
1201071137 Y:10148270-10148292 TGGGAGACAATTGGAATCATGGG + Intergenic
1201275929 Y:12298704-12298726 TAGGACACAATTGTGAACACTGG - Intergenic
1201319835 Y:12686445-12686467 CACGACACAATTGGACAAACTGG + Intergenic
1201324894 Y:12745606-12745628 TTGCACACAATTTGAAAAACTGG - Intronic
1201363470 Y:13179028-13179050 CAGGACACAATTGGAAACACTGG + Intergenic
1201397631 Y:13565833-13565855 CAAGACACAATTGAAAAAACTGG + Intergenic
1201636747 Y:16131635-16131657 CGGGACACAATTGGAGAAACTGG + Intergenic
1201864589 Y:18636238-18636260 AAGAACACAGTTGGAAAAACTGG + Intergenic
1201868733 Y:18684140-18684162 AAGAACACAGTTGGAAAAACTGG - Intergenic
1202061557 Y:20894590-20894612 CAGGACACTAGTGGAAAAACGGG + Intergenic