ID: 977753179

View in Genome Browser
Species Human (GRCh38)
Location 4:100633877-100633899
Sequence ATGTCACAGCTGAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 1, 2: 8, 3: 46, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977753178_977753179 -10 Left 977753178 4:100633864-100633886 CCAGAGAAGATGAATGTCACAGC 0: 1
1: 2
2: 6
3: 30
4: 197
Right 977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG 0: 1
1: 1
2: 8
3: 46
4: 377
977753175_977753179 28 Left 977753175 4:100633826-100633848 CCGAAGGACTGAGAACAAGGAGT 0: 1
1: 0
2: 20
3: 154
4: 643
Right 977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG 0: 1
1: 1
2: 8
3: 46
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977753179 Original CRISPR ATGTCACAGCTGAAGCAGAG AGG Intronic
900849213 1:5129023-5129045 TTGTCACAGCTGCAGAAGATAGG - Intergenic
900871330 1:5305755-5305777 ATGTCTCAGCTCAAGCAGCCAGG + Intergenic
901790711 1:11652549-11652571 ATGGCCCAGCTGAAGCCGACTGG - Intronic
902259980 1:15217681-15217703 ATGTCCCAGCTCAAGCAGTGAGG + Intronic
903334780 1:22617585-22617607 ATGTCACAGCTGAGGGTCAGAGG - Intergenic
903940521 1:26927217-26927239 TTGTCCCAGCTGGAGCACAGTGG + Intronic
903940530 1:26927320-26927342 TTGTCCCAGCTGGAGCACAGTGG + Intronic
905467785 1:38168685-38168707 ATGTCTCAGCTCAAGCAGACGGG - Intergenic
905913480 1:41669593-41669615 ATGTCCCAGCTCAAGCAGTCAGG - Intronic
906928301 1:50142565-50142587 TTTTCTCATCTGAAGCAGAGTGG - Intronic
907194750 1:52677359-52677381 CTGTCAGGGCTGATGCAGAGGGG - Intergenic
907477977 1:54719179-54719201 AGGTCACTGGTGCAGCAGAGGGG + Intronic
910044446 1:82894633-82894655 ATTTCAGAGCTGAGGGAGAGAGG + Intergenic
911994414 1:104746203-104746225 ATGATTCAGCTGAAGTAGAGTGG - Intergenic
912172991 1:107123393-107123415 ATGTTACAGCTGAAGGAGCCAGG - Intergenic
913123770 1:115766334-115766356 ATGTGGAAACTGAAGCAGAGAGG - Intronic
913699216 1:121357934-121357956 ATGTGGAAGCTGAAGCATAGAGG + Intronic
914138329 1:144922111-144922133 ATGTGGAAGCTGAAGCATAGAGG - Intronic
914754413 1:150554566-150554588 ATGGCGCAGGGGAAGCAGAGGGG - Intronic
915728858 1:158038414-158038436 ATGTTAAAGATGAAGCAGAGTGG + Intronic
915852210 1:159336618-159336640 ATGTCCCAGCTCAAGCAGAGGGG - Intergenic
916282293 1:163065027-163065049 ATTTTACAGATGAAGCATAGAGG - Intergenic
918213693 1:182374575-182374597 AGGTCACAGCAGAAGGGGAGGGG - Intergenic
918364094 1:183788317-183788339 ATGTCCCAGCTCAAGCAGTGAGG + Intronic
919067048 1:192705673-192705695 ATGTCTCAGCTCAAGCAGTCAGG - Intergenic
920486627 1:206376646-206376668 ATGTGGAAGCTGAAGCATAGAGG + Intronic
920729234 1:208467305-208467327 ATGTCACAGTTGACGCAGGCTGG - Intergenic
922039620 1:221883951-221883973 ATGTCCCAGCTCAAACACAGAGG + Intergenic
923791682 1:237116766-237116788 ATGTCGTAGCTCAAGCAGTGAGG + Intronic
923906845 1:238394476-238394498 GTGTCCCAGCTCAAGCAGTGGGG + Intergenic
924215330 1:241815158-241815180 ATGTCCCAGTTCAAGCAGAGAGG + Intergenic
1063052698 10:2470284-2470306 ATTGCACAGCAGCAGCAGAGTGG - Intergenic
1063906156 10:10782361-10782383 ATGTCCCAGCTCAATCAGTGAGG + Intergenic
1064370518 10:14748670-14748692 AGGTCAAAGTTGCAGCAGAGCGG + Intronic
1064540072 10:16396318-16396340 ATGTCACAGCTGGAAGAAAGCGG - Intergenic
1067420964 10:46147211-46147233 ATAACACAGCTGAGGAAGAGAGG - Intergenic
1067490790 10:46699832-46699854 ATAACACAGCTGAGGAAGAGAGG - Intergenic
1067506303 10:46853677-46853699 ATAACACAGCTGAGGAAGAGAGG - Intergenic
1067603873 10:47640535-47640557 ATAACACAGCTGAGGAAGAGAGG + Intergenic
1067834991 10:49632895-49632917 ATGTCTGAGCTGGAGCTGAGGGG - Intronic
1069064343 10:63926824-63926846 ATGTCCCAGCTCAAGCAGACAGG + Intergenic
1069123208 10:64595489-64595511 ATGTCCCAGCTCAAGCAGATAGG - Intergenic
1071111899 10:82168418-82168440 ATTTCACATCTGTAGAAGAGTGG - Intronic
1071231765 10:83596176-83596198 ATGTTCCAGCTCAAGCAGAGAGG - Intergenic
1071575813 10:86725268-86725290 ATCCCACAGCTGAAGCACAGTGG - Intronic
1072435347 10:95409352-95409374 ATGGCACCGCTGAAGGAGAATGG + Intronic
1072696712 10:97609357-97609379 ATTTCACAGATGAAGCAGCTTGG + Intronic
1072930369 10:99657464-99657486 ATATAACACTTGAAGCAGAGTGG + Intergenic
1073058826 10:100720501-100720523 ATGAGGCAGCTGAGGCAGAGAGG - Intergenic
1073899788 10:108206559-108206581 ATGTCTCAGCTCCAGAAGAGAGG + Intergenic
1074607638 10:114989483-114989505 ATGTCTCAGCTCAAGCAGAGAGG - Intergenic
1075270724 10:121047841-121047863 ATGTCCTAGCTTAAGCAGTGAGG + Intergenic
1075475065 10:122727433-122727455 GGCTCACAGCTGCAGCAGAGGGG - Intergenic
1075730846 10:124635749-124635771 AATTCACAGCTGAAGCAGCCCGG + Intronic
1077623728 11:3751492-3751514 ATTTCACAGCTGAAAAAGACTGG + Intronic
1078486802 11:11730857-11730879 TTGTCCCAGCTCAAGCAGTGAGG - Intergenic
1079727685 11:23896597-23896619 ATGTCTCAGCTCATCCAGAGTGG + Intergenic
1080344827 11:31312625-31312647 ATGTCCTAGCTGAAGCAGTAAGG - Intronic
1081286871 11:41281537-41281559 ATTTCACAGCTGAATCTGTGAGG + Intronic
1082796947 11:57384869-57384891 ATGAGAAAGCTGAGGCAGAGAGG - Intergenic
1082939995 11:58694554-58694576 ATGTCCCAGCTCAAGCTGTGAGG - Intronic
1086208321 11:84286873-84286895 ATCTCTCTGCAGAAGCAGAGAGG + Intronic
1087549614 11:99632393-99632415 ATTTCACAGCTAAAGTACAGGGG + Intronic
1087623380 11:100567761-100567783 ATCGTAGAGCTGAAGCAGAGAGG - Intergenic
1089213687 11:116822833-116822855 AGCTCAGAGCTGGAGCAGAGGGG - Intronic
1089733344 11:120533220-120533242 ATGTCACAGCTGGGTCAGAGGGG + Intronic
1089930623 11:122307265-122307287 GTGTCACAGCAGGAGCAGAAAGG - Intergenic
1090329630 11:125920844-125920866 TTGGCACAGCAGGAGCAGAGAGG + Intronic
1090746542 11:129710157-129710179 AGGCCACAGCTGACACAGAGAGG - Intergenic
1092864938 12:12751884-12751906 ATGTGACGGCAGAAGCAGATTGG + Intronic
1093929028 12:24936764-24936786 ATGCCACAGTGGAAGCAAAGGGG - Intronic
1094304907 12:29007918-29007940 ATGTCCCAGCTCAAGCAGTGAGG - Intergenic
1094568642 12:31622736-31622758 ATATCACAGCTGAAGAGGACTGG - Intergenic
1094669548 12:32555888-32555910 CTGTTACAGCTGGAGCACAGTGG + Intronic
1095198389 12:39352197-39352219 ATGCCAGAGCTGAGGTAGAGGGG - Intronic
1095871720 12:47035506-47035528 ATCGCACTGCTGAAGCAGGGAGG - Intergenic
1097318789 12:58202590-58202612 ATGTCCCAGCTGAAGCAGTCAGG + Intergenic
1097556363 12:61143766-61143788 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1098597000 12:72285304-72285326 ATATCACAGATGATGGAGAGAGG + Intronic
1099024315 12:77446475-77446497 ATCTGACAGCTGAAGAACAGCGG + Intergenic
1099417848 12:82415645-82415667 ATGTCTCAGCTTATGCAGTGAGG + Intronic
1100451407 12:94710576-94710598 AAGTTACAGCTGAAGAAGATGGG - Intergenic
1100579271 12:95923083-95923105 ATGTCCCAGTTCAAGCAGTGAGG - Intronic
1103145802 12:118594915-118594937 ATGTCAAAGCTGAAGCTGTGGGG + Intergenic
1103557735 12:121776176-121776198 GGCTCACAGCAGAAGCAGAGTGG - Exonic
1104361276 12:128135518-128135540 TTTTCACAGATGAAGCAGGGCGG - Intergenic
1106204303 13:27575532-27575554 ATGTCACAACTCAAGCAGTAAGG - Intronic
1107039040 13:35929691-35929713 AGGACACAGCTGAAGAAAAGTGG - Intronic
1107164765 13:37271293-37271315 ATGTCCCAGGTCAAGCAGAGAGG - Intergenic
1107807071 13:44163381-44163403 ATGTCCCAGCTGCGGAAGAGTGG - Intergenic
1107933223 13:45323676-45323698 ATGTCCCAGCTCAAGCAGGTGGG + Intergenic
1108148956 13:47511437-47511459 AGGTCACAGACGAGGCAGAGAGG + Intergenic
1108314841 13:49226794-49226816 ATGTCCCAGGTGAAACACAGCGG + Intergenic
1109888503 13:68575396-68575418 ATGTTCCAGCTCAAGCAGTGAGG + Intergenic
1110889633 13:80682231-80682253 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1111161864 13:84405439-84405461 ATGTAACTGCTAAAGGAGAGGGG - Intergenic
1112239412 13:97666387-97666409 ATGTCCCAGCTGAGGCAGTCAGG + Intergenic
1113357951 13:109601161-109601183 ATGGCACATCTGAAGCAGTGAGG - Intergenic
1113751487 13:112779444-112779466 CTGTCCCAGCTGAAGCACAGCGG - Intronic
1114163012 14:20190083-20190105 ATGTTAGAGCTGAATCATAGGGG + Intergenic
1114457479 14:22865592-22865614 AAGACAAAGCTGAGGCAGAGGGG + Intergenic
1115184689 14:30672441-30672463 ATGTCAGAGCTGAGGAAGGGGGG + Intronic
1115509410 14:34125120-34125142 ATGTCACAGATGTTGTAGAGGGG - Intronic
1115735264 14:36320754-36320776 ATGTCACAGCTGCAACTGATTGG - Intergenic
1116861270 14:49997529-49997551 ATGTCCCAGGTCAAGCAGTGAGG - Intronic
1116978117 14:51138492-51138514 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1117219319 14:53586392-53586414 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1117458625 14:55922514-55922536 ATGTCCCAGCTCAAGCAAAGAGG + Intergenic
1117796418 14:59398800-59398822 AGGGCAAGGCTGAAGCAGAGAGG - Intergenic
1118175168 14:63432597-63432619 ATGCCACAGGTCAAGGAGAGTGG - Intronic
1118377781 14:65191865-65191887 AGGTGAGAGCGGAAGCAGAGGGG + Intergenic
1118956496 14:70487915-70487937 ATGTGAAAGCAGGAGCAGAGGGG + Intergenic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1120086358 14:80278629-80278651 ATGTCCCAGCTGAAACAGTCAGG + Intronic
1120917292 14:89721256-89721278 AAGTTACAGCTTAAGGAGAGGGG - Intergenic
1121568200 14:94926235-94926257 AAGTCACAGCTGACCCAGACAGG - Intergenic
1121710459 14:96034886-96034908 ATGTCCCAGCTCAGGCAGTGAGG + Intergenic
1121715215 14:96068969-96068991 ATGTCTCAGCTGAAGCAGGCAGG - Intronic
1121835728 14:97090405-97090427 ATGTCCCAGCTCAAGCAGTCGGG + Intergenic
1121942340 14:98083049-98083071 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1122807918 14:104270031-104270053 GTGTCCCAGCTCAAGCAGCGTGG + Intergenic
1122875519 14:104662544-104662566 GTGTCCCAGCTCAAGCAGCGTGG - Intergenic
1122909319 14:104819352-104819374 CTGTCACCCCTGAAGCAGCGAGG + Intergenic
1124135465 15:27031858-27031880 AAGTGACAGCTGAAGCACCGTGG + Intronic
1124322410 15:28725124-28725146 ATGTCCCAGCACAAGCAAAGAGG + Intronic
1124698789 15:31893027-31893049 ATGTCTCAGCTCAAGCAGTAAGG + Intergenic
1124994907 15:34713971-34713993 ATGTAGCAGATGGAGCAGAGGGG + Intergenic
1125098733 15:35885347-35885369 ATGTAACAGCATAAACAGAGGGG - Intergenic
1125392474 15:39209157-39209179 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1125681086 15:41530578-41530600 ATGCCAGACCAGAAGCAGAGAGG - Intronic
1128258351 15:66214522-66214544 ATGACACAGCAGAAGAAGAAGGG + Intronic
1129555910 15:76509258-76509280 GTGTGAAAGCTGAAGAAGAGGGG - Intronic
1129673100 15:77617829-77617851 AAGTCACTGATTAAGCAGAGAGG + Intronic
1129799598 15:78404090-78404112 ATGAGGAAGCTGAAGCAGAGAGG - Intergenic
1130851866 15:87802696-87802718 ATGTCCCAGCTCAAGCAGTGAGG - Intergenic
1134395996 16:13863854-13863876 ATGTCCCAGCTCAAACAGTGAGG - Intergenic
1134843506 16:17421032-17421054 AAGTCACAGCTGTGGCAGAAGGG - Intronic
1135392730 16:22107257-22107279 TTGTCATTGCTGAAGGAGAGGGG + Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1136685718 16:31993847-31993869 ATGGCACAGCTGAAGCCGGCTGG - Intergenic
1136786331 16:32937380-32937402 ATGGCACAGCTGAAGCCGGCTGG - Intergenic
1136883443 16:33916415-33916437 ATGGCACAGCTGAAGCCGGCTGG + Intergenic
1137377764 16:47968394-47968416 ATGATAGAGCTGAAGCAGAGTGG + Intergenic
1137545891 16:49403123-49403145 AAGGGACAGCTGCAGCAGAGGGG + Intergenic
1137704570 16:50525737-50525759 ATGTCCCAGCTCAAGCAGTCAGG + Intergenic
1137745830 16:50819342-50819364 ATGTCCCAGCTCAAGCTGTGAGG - Intergenic
1137785560 16:51134797-51134819 ATGTCACTCCTGGAGCGGAGGGG + Intergenic
1138165477 16:54797462-54797484 ATGTCTCAGCTCAAGGAAAGAGG + Intergenic
1138287646 16:55822467-55822489 ATGTGGCAGCAGAAGCTGAGTGG + Intronic
1138710288 16:58963424-58963446 ATCTTACAGCTTAGGCAGAGAGG - Intergenic
1138719331 16:59060631-59060653 ATGTTCCAGCTCAAGCAGTGAGG - Intergenic
1138720033 16:59069236-59069258 ATGTCCCAGCTCCAGAAGAGAGG + Intergenic
1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141196948 16:81867206-81867228 ATGCCACAGCAGAAGCTGGGAGG + Intronic
1203088565 16_KI270728v1_random:1199046-1199068 ATGGCACAGCTGAAGCCGGCTGG - Intergenic
1143805735 17:9424564-9424586 GTGTCACAGTGGAAGAAGAGGGG - Intronic
1144058468 17:11561019-11561041 ATGTCATAGCTGGGACAGAGAGG + Exonic
1145895370 17:28454448-28454470 ATGTCCCAGTTCAAGAAGAGAGG - Intergenic
1147037146 17:37690269-37690291 CTGGCACAGCTAAAGCTGAGCGG + Intronic
1147959761 17:44159698-44159720 TTGTGGTAGCTGAAGCAGAGAGG + Intronic
1148717138 17:49723757-49723779 ATGTGACAGCTGCAGTGGAGAGG + Intronic
1149373343 17:56018657-56018679 ATGTAACTGCTGAAGCCAAGTGG - Intergenic
1150000505 17:61434130-61434152 ATGTCACAGCTGAAGGGGGATGG + Intergenic
1150679665 17:67274601-67274623 ATGTCCTAGTTGAAGAAGAGAGG - Intergenic
1151000321 17:70368710-70368732 ATGTCTCAGCTCAAACAGAGAGG + Intergenic
1153010245 18:532172-532194 TTGGCACAGCAGAAGCAGCGTGG + Intergenic
1153452417 18:5244434-5244456 ATGTCCCAGAACAAGCAGAGAGG + Intergenic
1153679207 18:7484428-7484450 ATGCCCCAGCTCAAACAGAGAGG + Intergenic
1153809405 18:8738771-8738793 ATGTCATAGATGCTGCAGAGTGG - Intronic
1155162792 18:23209169-23209191 ATGTCCCAGATCAAACAGAGTGG - Intronic
1157663719 18:49467914-49467936 TTGTTAAGGCTGAAGCAGAGGGG - Intergenic
1158025700 18:52894741-52894763 ATGTCCCAGCTCAAGCAGTCAGG + Intronic
1158227679 18:55217684-55217706 ATTTCACAGCTGAAGGAAATGGG + Intergenic
1158641649 18:59208574-59208596 TTGTCACAGCTCAAGTGGAGGGG - Intergenic
1162925645 19:13929621-13929643 AGGGCACAGCTGGAGCAGGGGGG + Exonic
1163377079 19:16939735-16939757 ATGTCCCAGCTCAAGCAGTTGGG - Intronic
1163793007 19:19319283-19319305 ATGTCAAGGATGAAGCAGAAGGG - Intronic
1164479467 19:28600234-28600256 GTGACACAGCTGCAGCAGTGGGG - Intergenic
1165934284 19:39379932-39379954 AGGACACCGGTGAAGCAGAGAGG - Intronic
1166269064 19:41702459-41702481 ACCTCACAGCAGGAGCAGAGTGG + Intronic
1167603490 19:50467639-50467661 AGGGCACAGCAGAAGCAGAGAGG + Exonic
1167857037 19:52250473-52250495 ATGTCCCAGCTCAAGCAGGAAGG - Intergenic
1168116732 19:54225128-54225150 TTGTCCCAGCTGAAGTACAGGGG - Intronic
1168522508 19:57063604-57063626 ATGTCAGTGCTCAAGCAGAGAGG - Intergenic
925604551 2:5645402-5645424 ATGTGTCAGCTCAAGCAGTGAGG + Intergenic
925627196 2:5853025-5853047 ATGTCCCAGCTGAAGCTGAGAGG - Intergenic
925641376 2:5988796-5988818 ATGTCTCAGGTCAAGCAGAGAGG + Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926779931 2:16461300-16461322 ATGTCCCAGCTCAAGCAGGAAGG + Intergenic
927457147 2:23262830-23262852 ATGTCCCAGCTCAAACAGACAGG - Intergenic
927717646 2:25362918-25362940 ATGTCACTGCAGAAGCCCAGAGG + Intergenic
927885488 2:26715734-26715756 ATTCCCCAGCTGAAGCGGAGGGG - Intronic
928284594 2:29978530-29978552 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
929089191 2:38197928-38197950 ATGTGAGGGCTGAGGCAGAGTGG - Intergenic
930542444 2:52723797-52723819 ATTTCACAGCAGAAGCAAATGGG + Intergenic
930884986 2:56315047-56315069 CTGTGACAGATGAAGCAAAGGGG - Intronic
931941355 2:67255103-67255125 ACTTCCCAGCTGTAGCAGAGGGG + Intergenic
935190073 2:100770215-100770237 GTGACACAGCTAAAGTAGAGGGG + Intergenic
935652742 2:105396346-105396368 ATGTCCCAGCTCAAGCAGTCCGG + Intronic
936008605 2:108910677-108910699 ATGTGAGAGCAGAAGCAGCGAGG + Intronic
936065637 2:109330128-109330150 ATCTCACAGCTGCCCCAGAGTGG - Intronic
936345003 2:111668851-111668873 ATGCCCCAGCTAAAGCAGTGAGG + Intergenic
936483935 2:112910663-112910685 ATGTCACCTTTGAAGAAGAGGGG + Intergenic
936628259 2:114172239-114172261 ATGTCCCAGCTCAAACAGGGAGG - Intergenic
936841958 2:116780208-116780230 ATCTCTCAACTGAAGCAGACAGG - Intergenic
937924946 2:127160842-127160864 ACGTCCCAGCTCAAGCAGTGAGG - Intergenic
938371216 2:130769483-130769505 TTGTAAGGGCTGAAGCAGAGGGG + Intergenic
940022792 2:149172796-149172818 ATGTCTCAGCTCAAGCAGTCAGG - Intronic
941492975 2:166165233-166165255 ATGTTACAGCTCAAGCACTGAGG + Intergenic
941620100 2:167767996-167768018 ATGTCCCAGCTCAAGCAGTCAGG + Intergenic
944920360 2:204406404-204406426 ATATCACATATGTAGCAGAGAGG - Intergenic
945457573 2:210067044-210067066 ATGTCCCAGCTTAAGAAGAAAGG - Intronic
945620665 2:212132549-212132571 ATGTCACAGTTCAAGCAGTCAGG - Intronic
946698811 2:222389000-222389022 ATGTGACGAGTGAAGCAGAGAGG + Intergenic
946908489 2:224438370-224438392 ATGTCTCAGCTCAAGCAGTCAGG - Intergenic
1169330678 20:4713817-4713839 ATGTGGCAGCTGAAGTGGAGGGG + Intergenic
1169982188 20:11396935-11396957 ATGTCCCAGCTCGAACAGAGAGG - Intergenic
1170471705 20:16674411-16674433 CTGTCCCAGCTGATGCTGAGTGG + Intergenic
1171088613 20:22262887-22262909 ATGTGAAAGCTGAAGCTCAGAGG - Intergenic
1172239800 20:33405293-33405315 ATGTCTCAGCTTAAGCAGTCAGG - Intergenic
1172241714 20:33417347-33417369 ATCTCAGAGCTCCAGCAGAGTGG + Intronic
1172997417 20:39081544-39081566 TTGTCACAGCTGCAGGGGAGGGG - Intergenic
1173281306 20:41630859-41630881 ATGTCCCAGTTCAAGGAGAGGGG - Intergenic
1173624609 20:44463284-44463306 ATCTCACAGGTGAAGCACGGTGG + Intronic
1174270604 20:49365597-49365619 AGGCCACAGCTGCAGGAGAGTGG + Exonic
1174525041 20:51163894-51163916 ATGTGAAGGCTGAATCAGAGAGG + Intergenic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1175322615 20:58100132-58100154 ACATCTCAGCTGAAGCAGAGAGG + Intergenic
1175520602 20:59600231-59600253 ATGCCTCATCTGGAGCAGAGAGG - Intronic
1175704305 20:61164712-61164734 TTGTCACAGCTGGAGAAGAGTGG + Intergenic
1176727008 21:10446100-10446122 ATTTTACAAATGAAGCAGAGAGG - Intergenic
1177251709 21:18599948-18599970 ATGGCACAGCAGAAACAGTGAGG + Intergenic
1177579332 21:22999259-22999281 ATGTTCAAGCTCAAGCAGAGGGG - Intergenic
1177798753 21:25806739-25806761 ATGCCCCAGCTCAAGAAGAGAGG - Intergenic
1177895522 21:26852551-26852573 ATGTCCCAGCTCAAGCAGGCAGG + Intergenic
1178062997 21:28872758-28872780 ATGTCACAGCTCAAACAATGAGG + Exonic
1178580647 21:33835245-33835267 AGGCCACAGCTCAAGCAAAGAGG - Intronic
1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG + Intronic
1178827591 21:36029648-36029670 ATGTCACAGAGGAAGCAGGTTGG - Intergenic
1179294530 21:40049369-40049391 GAGTCACAGCAGGAGCAGAGGGG - Intronic
1179409465 21:41151209-41151231 ATGTGACAGCTGCAGCAGTTAGG - Intergenic
1180287379 22:10760924-10760946 ATTTTACAAATGAAGCAGAGAGG + Intergenic
1180966226 22:19789236-19789258 AGGTCCCAGCTGCAGGAGAGGGG + Intronic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1181832325 22:25570722-25570744 AAGACACAGGAGAAGCAGAGGGG - Intronic
1182126416 22:27819073-27819095 ATGTCAAGGCTGCTGCAGAGGGG + Intergenic
1182347822 22:29679178-29679200 ATCCCACAGCTGATGCAGAGGGG + Intronic
1182941180 22:34279337-34279359 ATGTCCCAGCTCAAGCAATGAGG + Intergenic
1183958382 22:41396224-41396246 ATGTCCCAGTTGAATCAGAAGGG + Exonic
1184982841 22:48106484-48106506 ATGTCAGAGCCGAGGCAGAGTGG - Intergenic
949348261 3:3097577-3097599 AAGTCACAGCTCAAGGACAGAGG + Intronic
949415568 3:3810314-3810336 ATATCACAGTGGAGGCAGAGAGG - Intronic
949479168 3:4477090-4477112 ATGACACAGCTGGACCACAGTGG + Intergenic
949654527 3:6201636-6201658 ATGTCACAACTGGAGCTGAAGGG + Intergenic
950350450 3:12345819-12345841 CTGTCACTGGTGAAGCACAGTGG - Intronic
953551484 3:43907018-43907040 AAGGCCCAGCTGAAGCAGAGAGG + Intergenic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
956499325 3:69864947-69864969 ATGTCATAACTGCTGCAGAGAGG - Intronic
956564567 3:70621497-70621519 ATGTCTAAGCTAAAGCAAAGAGG - Intergenic
957973809 3:87417551-87417573 ATGTAACAGCTCAAGCAGTTAGG - Intergenic
958087138 3:88824938-88824960 ATGGCACAGCTGGAGTACAGTGG + Intergenic
959457362 3:106579370-106579392 ATGTGACAACTGAGGTAGAGAGG + Intergenic
959557650 3:107740358-107740380 ATGTCAGAGCTGAGGGAAAGGGG - Intronic
962678725 3:137776770-137776792 ATGATAAAGCTGAAGCAGTGTGG - Intergenic
962959887 3:140301003-140301025 ATGTCCCAGCTCAAGCAGGAAGG + Intronic
964641015 3:158910686-158910708 ATGTTACAGCTCCAGCAGTGTGG + Intergenic
964734926 3:159907234-159907256 AGGGCACAGTGGAAGCAGAGAGG - Intergenic
964763250 3:160154252-160154274 ATGCCACAGCAGCAGAAGAGAGG + Intergenic
966133812 3:176675328-176675350 ATGTCCCAGCTCAAGCAGTTAGG + Intergenic
966497311 3:180595830-180595852 ATGTCCCAGCTCAAACAGTGGGG + Intergenic
966865008 3:184253473-184253495 ATGTCACGACTGAAGGTGAGTGG + Intronic
967567637 3:190990735-190990757 ATGGTACAGCTGATGTAGAGAGG + Intergenic
968510456 4:993258-993280 AGATCTCAGCTGCAGCAGAGGGG - Intronic
968863025 4:3187608-3187630 AAGTCACAGCTGAAGAAAAAAGG - Intronic
969696575 4:8738417-8738439 ATGTCACAGCTGATGCAGATCGG + Intergenic
969827740 4:9771364-9771386 AGGTCACTGCAGAAGGAGAGAGG + Intronic
970818394 4:20185343-20185365 TTATCACAGCTGAAGGAGTGTGG - Intergenic
971054668 4:22898781-22898803 ATCTTACAGCTGAAGAAAAGGGG + Intergenic
971592491 4:28485693-28485715 ATGCCCCAGCTGATGCTGAGTGG + Intergenic
972862818 4:43191814-43191836 ATGTTACAGATGAAGCAGTTGGG - Intergenic
973249854 4:48049445-48049467 ATGTTACAGTTGAAAGAGAGTGG + Intergenic
975314450 4:72934987-72935009 ATGTCTCAGCTCAAGCAGTCAGG - Intergenic
977009654 4:91621362-91621384 ATGTCCCAGATCAAGCAGTGAGG - Intergenic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
978502558 4:109424632-109424654 TTGTGATAGCTGAAGCAGAGAGG - Intergenic
979744348 4:124191875-124191897 AAGTGATGGCTGAAGCAGAGTGG + Intergenic
980048788 4:128018120-128018142 GTGTCACAGCTGAAACAGAAGGG - Intronic
980382706 4:132045254-132045276 ATGTCACAGCTGAAGCAGTGAGG + Intergenic
980576136 4:134685292-134685314 AGGACACAGCTGAAGCAGTATGG - Intergenic
981442717 4:144801083-144801105 ATGTCCCAGATGAAGCAGTGAGG - Intergenic
981608723 4:146569297-146569319 ATGTCCCAGCTCAAGAAAAGAGG + Intergenic
982599047 4:157422496-157422518 ATGGGACTGATGAAGCAGAGAGG + Intergenic
983375372 4:166921134-166921156 CTGTCAGAGCTAATGCAGAGTGG - Intronic
984681077 4:182609533-182609555 AGGTTACAGCAGAATCAGAGGGG - Intronic
985560041 5:580639-580661 AAGTCACAGCAGAAGGCGAGAGG + Intergenic
985662040 5:1162148-1162170 AAGTCACAACAGAAGCCGAGGGG + Intergenic
986082418 5:4408676-4408698 TGGTCCCAGCTGAAGCAGATAGG - Intergenic
987380628 5:17282505-17282527 ATGTCTGTGCTGAGGCAGAGTGG - Intergenic
990288912 5:54329009-54329031 ATGTGACAGCAGAGGCAGAGTGG - Intergenic
990471976 5:56123901-56123923 CTGTGACAGCTGAGGCAGATTGG - Intronic
992049815 5:72931832-72931854 ATTCCCCAACTGAAGCAGAGTGG + Intergenic
992157989 5:73973440-73973462 ATGTGACAACAAAAGCAGAGAGG + Intergenic
992178845 5:74177246-74177268 ATGCCCCAGCTCAAGAAGAGAGG + Intergenic
992664565 5:78994445-78994467 ATCCCTCAGGTGAAGCAGAGTGG - Intergenic
993013203 5:82507498-82507520 ATGTTCCAGCTCAAGCAGTGAGG - Intergenic
994296992 5:98102425-98102447 ATGTCACAGCAGAAATAGAGGGG - Intergenic
995706865 5:114995916-114995938 ATTTCCCAACTGAAGCATAGTGG + Intergenic
996774761 5:127121315-127121337 AAGTCACAGCTGAAGCAGCTGGG + Intergenic
997293618 5:132755536-132755558 ATTTTATAGCTGAAGCACAGAGG - Intronic
997410484 5:133687147-133687169 ATGTCACAACTCAAGGAGTGTGG + Intergenic
999632600 5:153586114-153586136 ATGTCAGAGCTGGTGCATAGTGG - Intronic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1001775529 5:174326543-174326565 ATGTCACAGCGAAAGCTGGGAGG + Intergenic
1003599698 6:7505625-7505647 GTGTGGCTGCTGAAGCAGAGAGG - Intergenic
1003829782 6:9995196-9995218 ATGTCACAACTGGGGAAGAGGGG - Intronic
1004691961 6:17999845-17999867 ATGTCTCAGCTCAAGCAGCCAGG + Intergenic
1005274800 6:24205071-24205093 TTTTCAAAGCTGGAGCAGAGAGG - Exonic
1005443812 6:25900068-25900090 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1005947754 6:30606688-30606710 CTGTCAGAGGTGAAGCAGACTGG + Intronic
1006502178 6:34466086-34466108 AGGTCAGAGCTGAGGCGGAGAGG - Exonic
1007101891 6:39254347-39254369 ATGTCAAAGCTGGTGCACAGAGG - Intergenic
1007271907 6:40644173-40644195 ACTTCACAGCTGAAGAAGTGTGG - Intergenic
1009762040 6:68020053-68020075 GTGTAACAGTTGAAACAGAGAGG - Intergenic
1009967278 6:70590979-70591001 ATGTCCTAGCTCAAGCAGTGAGG + Intergenic
1011785374 6:90837687-90837709 ATGTCTCAGCTCAAGCAGTCAGG - Intergenic
1012440529 6:99257987-99258009 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1013430571 6:110051561-110051583 ATGTCCCAGCTTAAGCAGAGAGG - Intergenic
1014179291 6:118367228-118367250 ATGTAACAGCTGAAGTGGATTGG + Intergenic
1016151982 6:140751846-140751868 ATGTCTCAGCTCAAGCAGTCAGG - Intergenic
1016367219 6:143332523-143332545 ATGTCACATCTGAAGATCAGAGG + Intronic
1016522088 6:144957262-144957284 ATGTTCCAGCTCAAGCAGACAGG + Intergenic
1018719015 6:166558287-166558309 ATGTCACAGCTCAAGCTGTCAGG + Intronic
1019255123 7:44760-44782 ATTTCACAGTTGAAGAAGTGAGG + Intergenic
1019696029 7:2446610-2446632 AGGTCCCAGCTGGAGCAGGGAGG - Intergenic
1021745429 7:23736046-23736068 ATATCCCTGCTAAAGCAGAGAGG - Intronic
1022708470 7:32829580-32829602 GTGTCAAGGTTGAAGCAGAGTGG - Intergenic
1022914704 7:34935897-34935919 GTGTCAAGGTTGAAGCAGAGTGG + Intronic
1023133315 7:37025594-37025616 ATGTCCCAGCTCAAGCAGTGAGG - Intronic
1023178225 7:37454343-37454365 GTGGAACAGCTGGAGCAGAGGGG - Intergenic
1023287246 7:38632020-38632042 AAGTCAGAGCTGCAGGAGAGAGG + Intergenic
1023861514 7:44220021-44220043 AAGTGACAGCTGGGGCAGAGGGG - Intronic
1024040713 7:45551350-45551372 ACGTTACAGCTAAAGCAGTGAGG + Intergenic
1024293717 7:47826410-47826432 ATGTCACATTTAAAGGAGAGTGG - Intronic
1024895337 7:54253989-54254011 TTGTAAGAGCTAAAGCAGAGGGG + Intergenic
1025887337 7:65609573-65609595 ATGTCCCAGCTCAAGCAGTCAGG + Intergenic
1026151617 7:67792496-67792518 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1026358497 7:69581062-69581084 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1026635086 7:72075110-72075132 AGGTCCCAGCTGAAGCAGTCAGG + Intronic
1028353910 7:89883182-89883204 ATGTCACAGCCAAAGCAGTGAGG - Intergenic
1028657503 7:93227152-93227174 TTTTCACAGCTGATGCATAGAGG + Intergenic
1028884816 7:95919629-95919651 ATGTGACAGCTCACACAGAGAGG - Intronic
1029582469 7:101446431-101446453 AGATCACAGCTGATACAGAGAGG + Intronic
1029732723 7:102448356-102448378 AGGTTACAGCTGGAGAAGAGGGG - Exonic
1029926269 7:104322101-104322123 AGGTCACAGCTGAAGCAAGCAGG - Intergenic
1031855075 7:126912357-126912379 ATGTCCCAGCTCAAGCAGTCAGG - Intronic
1032735239 7:134686745-134686767 ATGTAACCTCTGAAGCAGAGGGG + Intergenic
1032862904 7:135898507-135898529 ATGTCCCAGCTCAAGTAGTGAGG + Intergenic
1033496547 7:141902980-141903002 ATGTCCCAGCTCAAGCAATGAGG + Intergenic
1034603093 7:152281812-152281834 ATTTTACAAATGAAGCAGAGAGG + Intronic
1034696221 7:153056324-153056346 ATGTGCCAGCTCAAGAAGAGAGG + Intergenic
1034971271 7:155420807-155420829 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1035066645 7:156109843-156109865 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1035670001 8:1409765-1409787 AGGTCCCAGCTCAAGAAGAGAGG - Intergenic
1037088633 8:14884923-14884945 AAGTCACAGCTGAGAGAGAGGGG - Intronic
1037381624 8:18291465-18291487 ATGCCAAAGCTTATGCAGAGAGG + Intergenic
1039600037 8:38828734-38828756 AGGACACAGCAGAAGCAGGGAGG - Intronic
1041799507 8:61784002-61784024 ATGTCCCAGCTGAAGCAGTGAGG + Intergenic
1042045583 8:64647670-64647692 ATGTCCCAGCTGAAACAGTGAGG + Intronic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1042804037 8:72752485-72752507 ATGTCCCAGCTCCAGCAGTGAGG - Intronic
1043021625 8:75008644-75008666 ATATAAGTGCTGAAGCAGAGGGG - Intronic
1043960913 8:86417229-86417251 ATGCCCCAGCACAAGCAGAGAGG + Intronic
1044405889 8:91825573-91825595 ATGTCTCAGCTCAAGCAGTAGGG - Intergenic
1045051749 8:98333794-98333816 ATGTCCCAGCTCAAGCAGCCCGG - Intergenic
1047198879 8:122746902-122746924 AAGTCACAGCTCAAGCAGTCAGG + Intergenic
1047764168 8:127976828-127976850 AGCTCAGAGCTGAAGCAGACAGG - Intergenic
1048590529 8:135816939-135816961 ATGTCCCAGCTCAAGCAGTCAGG - Intergenic
1049084871 8:140470799-140470821 ATGGCAAAGCTGGAGCAGGGTGG - Intergenic
1049676060 8:143889760-143889782 GTGACACAGCTGAACCTGAGGGG + Intergenic
1049734621 8:144198321-144198343 ATGTCACACCTGAATTAGTGGGG + Intronic
1049941048 9:546287-546309 TTGTTATAGCTGAATCAGAGAGG + Intronic
1049963859 9:761075-761097 AGGTCCCAGCTCAAGCAGAACGG + Intergenic
1050341361 9:4642644-4642666 ATGTCTCAACTAAAGCAAAGAGG - Intronic
1051063433 9:13072838-13072860 ATGTCCCAGCTCAAGCAGTGAGG + Intergenic
1051187431 9:14474893-14474915 ATGTCTCAGTTTAAGCAGAGAGG + Intergenic
1051347330 9:16164002-16164024 AAGTCACAGATGAAACAGTGGGG + Intergenic
1051910673 9:22151761-22151783 ATGTCACAGCTACATAAGAGTGG - Intergenic
1052339865 9:27354309-27354331 ATTTCACTGCTAAAACAGAGAGG + Intronic
1052398648 9:27972981-27973003 ATGTCTCAGCTCAAGAAGAGAGG - Intronic
1052965507 9:34337743-34337765 GTTGCACAGCTGATGCAGAGAGG - Intronic
1053099975 9:35363594-35363616 ATGTCACATCACAAGTAGAGGGG - Intronic
1053523841 9:38808962-38808984 AGATGAGAGCTGAAGCAGAGAGG - Intergenic
1053748130 9:41221682-41221704 ATGTTACAGAGGAAGCAGTGGGG - Intergenic
1055194591 9:73573287-73573309 ATGTCTCTGCTTTAGCAGAGAGG - Intergenic
1055223108 9:73962841-73962863 ATGTCCCAGCTCAAGCAGGCAGG + Intergenic
1055997192 9:82172767-82172789 AGGTCAAAGGGGAAGCAGAGAGG + Intergenic
1056105742 9:83344570-83344592 ATGTCCCAGCTTAAGCAGTCAGG - Intronic
1056308273 9:85312963-85312985 ACGGCACAGCTGGAGAAGAGAGG + Intergenic
1056317133 9:85400907-85400929 ATGTCACTGCTGATGAAGAAAGG + Intergenic
1056964198 9:91152456-91152478 ATGTCCCAGCTCAAGCATGGAGG + Intergenic
1058071799 9:100608963-100608985 ATGTCTCAGCTCAAGCAGTGAGG + Intergenic
1059773245 9:117447882-117447904 ATGGGGCAGCCGAAGCAGAGAGG - Intergenic
1060970885 9:127737198-127737220 GGGTCACAGCAGCAGCAGAGTGG - Intergenic
1061311498 9:129766200-129766222 ATGTCTCAGCTCAAGCAGGCAGG + Intergenic
1061453742 9:130682472-130682494 ATGTCACAGCTGAAGGGGAGGGG - Exonic
1062380373 9:136284105-136284127 ATGTCCCAGCAGGAGGAGAGGGG + Intronic
1062487249 9:136785294-136785316 TTGTGGTAGCTGAAGCAGAGAGG + Intergenic
1062639622 9:137511872-137511894 TTGTGGTAGCTGAAGCAGAGAGG - Intronic
1202784258 9_KI270718v1_random:32383-32405 ATGTTACAGAGGAAGCAGTGGGG - Intergenic
1185715397 X:2337986-2338008 TTGTCTCAGCTGAGGCACAGCGG - Intronic
1186313704 X:8346493-8346515 ATGTCCCAGCTCAAGCAGCCAGG - Intergenic
1187522078 X:20022585-20022607 ATGTGACAGCTGATGAAGACTGG + Intronic
1189139519 X:38587071-38587093 ATGTCACAACTGAAGAGGAAAGG + Intronic
1189665771 X:43353244-43353266 ATGTACCAGCTGAAGCAGTAAGG - Intergenic
1189824501 X:44903532-44903554 AAGTCACAGAAGAAGGAGAGGGG - Intronic
1191673798 X:63773804-63773826 ATGTCCCAGCTCAAGCAGTCAGG - Intronic
1192235854 X:69295519-69295541 ATGCCTCAGCTGGGGCAGAGTGG - Intergenic
1192585758 X:72317032-72317054 AGGCCACAGCTGGAGCTGAGAGG - Intergenic
1194267972 X:91778719-91778741 AAGTCACAGTTGGAGCTGAGAGG - Intergenic
1197952255 X:131910207-131910229 ATGTGACAGAAGAAGCAGATTGG - Intergenic
1198139470 X:133788453-133788475 ATGTCAGAGGTGAAACAGTGAGG - Intronic
1198450825 X:136766109-136766131 ATGCCTCAGCTGAAGCACAAGGG + Intronic
1199382685 X:147189432-147189454 ATGTCTCAGCTGACGAAGAATGG + Intergenic
1199777137 X:151022088-151022110 ATGTCTCAGCTCAAGCAGTCAGG - Intergenic
1200164978 X:154029714-154029736 ATGCCAGAGCTGGAGCAGACAGG + Intronic
1202243265 Y:22791685-22791707 ATTCCCCACCTGAAGCAGAGTGG + Intergenic
1202266079 Y:23020720-23020742 ATGCCGCAGCTGCAGCAAAGTGG + Intergenic
1202396252 Y:24425435-24425457 ATTCCCCACCTGAAGCAGAGTGG + Intergenic
1202419072 Y:24654463-24654485 ATGCCGCAGCTGCAGCAAAGTGG + Intergenic
1202451714 Y:25015621-25015643 ATGCCGCAGCTGCAGCAAAGTGG - Intergenic
1202474532 Y:25244657-25244679 ATTCCCCACCTGAAGCAGAGTGG - Intergenic