ID: 977755982

View in Genome Browser
Species Human (GRCh38)
Location 4:100672746-100672768
Sequence GGTCCGTGTGATCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977755978_977755982 8 Left 977755978 4:100672715-100672737 CCAGAAAAAGAAAGAACTGATTG 0: 1
1: 1
2: 0
3: 45
4: 469
Right 977755982 4:100672746-100672768 GGTCCGTGTGATCCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977755982 Original CRISPR GGTCCGTGTGATCCACAAGC AGG Intronic
No off target data available for this crispr