ID: 977756864

View in Genome Browser
Species Human (GRCh38)
Location 4:100682341-100682363
Sequence TCATGCAATTATAGTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977756859_977756864 26 Left 977756859 4:100682292-100682314 CCACTCTTTGCTCTGTGGCATGG 0: 1
1: 0
2: 0
3: 17
4: 265
Right 977756864 4:100682341-100682363 TCATGCAATTATAGTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 160
977756863_977756864 -7 Left 977756863 4:100682325-100682347 CCTGTAGGAAGTAAGTTCATGCA 0: 1
1: 0
2: 1
3: 4
4: 89
Right 977756864 4:100682341-100682363 TCATGCAATTATAGTGATACAGG 0: 1
1: 0
2: 0
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977756864 Original CRISPR TCATGCAATTATAGTGATAC AGG Intronic
901111606 1:6801257-6801279 TGATGCAAATATGGTGATAGTGG + Intronic
902474164 1:16672458-16672480 TCCTGCAATTATAATTATAGTGG + Intergenic
902484639 1:16734984-16735006 TCCTGCAATTATAATTATAGTGG - Intergenic
906092718 1:43196156-43196178 TCATGCATTTGCAGTGAAACCGG + Intronic
906401948 1:45510920-45510942 TCAGGGAATTATATTGACACAGG - Exonic
907887074 1:58602467-58602489 TTTTGGAATTATGGTGATACTGG + Intergenic
908092227 1:60698433-60698455 TCAGGCAATTATTGTCACACTGG + Intergenic
909334116 1:74450920-74450942 TCATTCTATTATAAAGATACAGG + Intronic
910341968 1:86198872-86198894 TCATTTAAGTATAGGGATACAGG - Intergenic
914922573 1:151857510-151857532 TCAAGAAAATAAAGTGATACAGG - Intergenic
917270618 1:173269486-173269508 GCATGCAAAAATAGTGATGCTGG - Intergenic
918442514 1:184582008-184582030 TCAGGTAATTGTATTGATACTGG + Intronic
920759201 1:208765688-208765710 TGTTACAAATATAGTGATACAGG - Intergenic
920778059 1:208959836-208959858 TCTTGAAATTATAATAATACTGG + Intergenic
921770447 1:219032045-219032067 TCATGCATTTGTGGTGATACTGG + Intergenic
922496310 1:226061239-226061261 TCATGAAATAATAATGAAACGGG + Intergenic
1064649302 10:17492022-17492044 TCATGTAATGATTGTTATACAGG - Intergenic
1064847951 10:19677133-19677155 TCATTCTATTATAAAGATACGGG - Intronic
1064920336 10:20509786-20509808 TCATGTGATTATAGTAATGCTGG + Intergenic
1065320006 10:24500460-24500482 CAATGCAATTCTATTGATACAGG - Intronic
1065343961 10:24730924-24730946 GCAAGCAATTATAGGGATAGAGG - Intergenic
1067898405 10:50211369-50211391 AAGTGAAATTATAGTGATACAGG + Intronic
1068914698 10:62416901-62416923 ACATTAAATTATAGTAATACAGG - Intronic
1071838264 10:89441492-89441514 TCATTCTATTATAGTCATAATGG + Intronic
1072103209 10:92249025-92249047 TCATGTATTTGTTGTGATACTGG + Intronic
1072703494 10:97662433-97662455 ACCTGAAATTAAAGTGATACTGG - Intronic
1072863761 10:99035661-99035683 TCATGTGTTTATAGTGATGCTGG - Intronic
1080282435 11:30573254-30573276 TCATGTGTTTATGGTGATACTGG + Intronic
1081375565 11:42354105-42354127 TTATGGAATTAGAGTGACACAGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1082858608 11:57831903-57831925 TCATGTATTTGTGGTGATACTGG - Intergenic
1087715721 11:101606517-101606539 TCATGCAATTTTAGAGTTTCAGG - Intronic
1090281983 11:125464209-125464231 TTATGGAATTATAGAGACACAGG - Intronic
1091358498 11:134956576-134956598 TCATGCAATTCTAATGAGAGAGG + Intergenic
1099774363 12:87105126-87105148 TCATTCAATTATAGGAATATGGG - Intergenic
1101651285 12:106679571-106679593 GTATGCACTTATATTGATACTGG + Intronic
1108747179 13:53408176-53408198 TCATGCATTTGTGGTGATGCTGG - Intergenic
1108901885 13:55421372-55421394 CCTTGCTATTATAGTGATACAGG - Intergenic
1109253315 13:60047462-60047484 TAATCAAATTAGAGTGATACAGG + Intronic
1109691265 13:65893017-65893039 TCATGGAATCAAAGTGTTACAGG + Intergenic
1111318841 13:86596914-86596936 TCATGCAAATAGAATCATACAGG - Intergenic
1112094116 13:96113632-96113654 TCATGAAATTATGGTGAAATGGG + Intronic
1114316915 14:21518137-21518159 TCAAGCAATTCAAGTGATTCAGG + Intergenic
1114737632 14:25058724-25058746 TGATAAAATTATAGTGACACTGG - Intergenic
1115172084 14:30520047-30520069 TTATGTAATTGTATTGATACAGG + Intergenic
1115659595 14:35479398-35479420 GCATGTAATTATAGTAACACAGG - Intergenic
1116979089 14:51149060-51149082 TCTTGCAATTCTAGTTAAACAGG + Intergenic
1117197090 14:53351297-53351319 ACATTCAATAATAGTGATTCAGG - Intergenic
1117472956 14:56065043-56065065 TCATTCTATTATAAAGATACAGG + Intergenic
1117502615 14:56368496-56368518 TCATTCTATTATAAAGATACAGG - Intergenic
1118934068 14:70269913-70269935 TCATGCAATTATGGTGACTGAGG - Intergenic
1121157189 14:91697122-91697144 TCATGAATTTAGAGTGAGACTGG + Intronic
1121486446 14:94320110-94320132 TCCTGTATTTATTGTGATACAGG - Intronic
1124699227 15:31896727-31896749 TAATGCAAATATAGAGATAGAGG - Intergenic
1131687983 15:94791993-94792015 TCATGCAAATATAGTGACCTGGG + Intergenic
1134559873 16:15199246-15199268 TCATTCTATTATAAAGATACAGG + Intergenic
1134920413 16:18110856-18110878 TCATTCTATTATAAAGATACAGG + Intergenic
1135883729 16:26284614-26284636 TCATGCAATCAGTGTGAGACTGG - Intergenic
1137349853 16:47704000-47704022 TCATTCTATTATAAAGATACCGG + Intergenic
1137955334 16:52823848-52823870 TCATTCTATTATAAAGATACAGG + Intergenic
1151059119 17:71070548-71070570 TCATGTATTTGTAGTGATGCTGG - Intergenic
1155865270 18:30957081-30957103 TTATGAAATTATAGTCATTCTGG - Intergenic
1157788588 18:50509193-50509215 TGATGCAAATATAGTTAGACAGG + Intergenic
1158921122 18:62191863-62191885 TCATTCTATTATAAAGATACAGG - Intronic
1164116094 19:22220301-22220323 TCTTGGTATTAGAGTGATACTGG + Intergenic
1164408159 19:27973112-27973134 AAAAGCAATTAGAGTGATACAGG + Intergenic
925635937 2:5941508-5941530 TCATTCACTTATAGAGAAACTGG + Intergenic
926474110 2:13301039-13301061 TGATGGAATTATAGTGATTATGG + Intergenic
927596095 2:24399299-24399321 TCAAGCAGTAATATTGATACAGG + Intergenic
927742613 2:25585576-25585598 TCATGTTATTTTATTGATACTGG - Intronic
929815612 2:45228917-45228939 TCATGCTATTATACTGCTAGTGG + Intergenic
931029830 2:58160739-58160761 TCATGAAATTACAGAAATACAGG - Intronic
931926601 2:67080051-67080073 TCATGAAATTGTAGTGCTATGGG + Intergenic
938872452 2:135494206-135494228 TCATGCCATTCTCCTGATACAGG - Intronic
940075729 2:149739721-149739743 ACATGCCATTCTAGTGAGACAGG + Intergenic
943014627 2:182495865-182495887 TCATGAAATTATACTGACATTGG - Intronic
943949839 2:194119588-194119610 TCATGATATTATGGTTATACTGG - Intergenic
944761300 2:202817678-202817700 TCATGAAATATTAATGATACAGG - Intronic
946129183 2:217592522-217592544 TGAAGCAATTAAAATGATACAGG - Intronic
947559737 2:231138284-231138306 TTATTCAACTAAAGTGATACTGG + Intronic
948952244 2:241261388-241261410 TCATGTAATCATATTGATAGTGG - Intronic
1169850674 20:10046840-10046862 TTATGCTATTATAGTTATGCGGG - Intronic
1170221312 20:13944975-13944997 TCATGAAATTAAAATGAGACTGG + Intronic
1175577515 20:60072936-60072958 TCATGCAATACTAATGATAAAGG + Exonic
1176653761 21:9572094-9572116 TCATGCCAGTAGAGTGAAACAGG - Intergenic
1176890189 21:14307117-14307139 ACATTCAATTATAGTGAAATAGG - Intergenic
1179079574 21:38158398-38158420 TCATGCAAATAGAGTGAAGCCGG + Intronic
951509875 3:23488575-23488597 TTATGCAATTAGAATGATACCGG + Intronic
951887686 3:27539966-27539988 TCCTGTAATGATAGTGATAGTGG + Intergenic
957725694 3:84063884-84063906 TCACTCAATTATAGTGTTATTGG + Intergenic
958849437 3:99306173-99306195 TCATGCTATTATAAAGACACAGG + Intergenic
959591636 3:108088843-108088865 TCATGCAATTACAGGCAAACTGG - Intronic
960789713 3:121415073-121415095 TGATGCAATTAAAATCATACTGG + Intronic
961756755 3:129132322-129132344 TCAAATAATTATAGAGATACAGG - Intronic
965487575 3:169296665-169296687 TAATGGAATTATAGTAATAAAGG + Intronic
965782530 3:172302207-172302229 TCATGCAATAATACTAATATGGG - Intronic
970467311 4:16338046-16338068 TCATGCCATTATTGTGACAATGG - Intergenic
970469942 4:16367760-16367782 TCATGCTACTATAGAGACACAGG - Intergenic
970736758 4:19179539-19179561 TCATGCAAATATAGAAACACAGG - Intergenic
971099397 4:23446696-23446718 TCATGTAATTTTAGTGTTAAAGG - Intergenic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
972701901 4:41502378-41502400 TCATTCTATTATAAAGATACAGG - Intronic
973892591 4:55382853-55382875 TAATGGGATAATAGTGATACTGG - Intergenic
974318991 4:60319505-60319527 TCATGTATTTATAGTGATGCTGG - Intergenic
974348347 4:60711829-60711851 TTCTAAAATTATAGTGATACAGG - Intergenic
974415849 4:61606005-61606027 AGATGCAATGAGAGTGATACAGG + Intronic
975212270 4:71714829-71714851 TCATGCCATTATTGTCATAGTGG + Intergenic
977312963 4:95410284-95410306 TCATGCATTTAGAGTGGTACAGG - Intronic
977756864 4:100682341-100682363 TCATGCAATTATAGTGATACAGG + Intronic
978175122 4:105720844-105720866 TCATTCAATTCTGGTGAAACTGG - Intronic
978780633 4:112549601-112549623 TCATGTATTTGTGGTGATACCGG + Intronic
983028436 4:162767074-162767096 TCAAGTAATTAAAGTAATACAGG - Intergenic
984124398 4:175788672-175788694 TCATGCATCTATAGTGTTACAGG + Intronic
984230090 4:177085757-177085779 TCATGGATTTCTAGTGAGACTGG + Intergenic
984285820 4:177727310-177727332 TCTTGTTATTATAGAGATACAGG + Intergenic
984496417 4:180503467-180503489 TAATACAATTAAAGTGATAAAGG + Intergenic
985038408 4:185864504-185864526 TGAAGCAAATATAGTGATAGTGG - Intronic
985074144 4:186195930-186195952 TCCTGTAATTATAGGAATACTGG - Intronic
986058661 5:4165274-4165296 ACATATAATTACAGTGATACAGG - Intergenic
986815644 5:11406553-11406575 TCATGCAATAATAATAATAAAGG - Intronic
987904774 5:24061424-24061446 TCTTTCAAATATAGTTATACTGG - Intronic
988241447 5:28614268-28614290 TCATGCATTTAAATGGATACAGG + Intergenic
988780824 5:34520295-34520317 TCATGTGTTTATAGTGATGCTGG - Intergenic
991279979 5:64902233-64902255 TCATGCATTTGTAGTTATGCTGG - Intronic
993354671 5:86891251-86891273 TCATGCATTTATAGTGAGATTGG - Intergenic
994505357 5:100636839-100636861 TCATCCAGTTATAGAGATTCAGG + Intergenic
996262046 5:121483766-121483788 TCATGGAATTAAAGTCAAACCGG - Intergenic
997021790 5:130011129-130011151 TTTTGCTATCATAGTGATACTGG - Intronic
1004152079 6:13130812-13130834 TTTTGGAATTAGAGTGATACTGG - Intronic
1004826603 6:19428211-19428233 TTATTCATTTATAGTTATACAGG - Intergenic
1007837821 6:44688842-44688864 TTTTGGAATTAGAGTGATACTGG + Intergenic
1008185050 6:48378444-48378466 TCATGCAAATAGAATGATGCTGG - Intergenic
1009547915 6:65045983-65046005 TGATGCAATAATAATGAAACAGG - Intronic
1010953737 6:82067580-82067602 TCAAGCCATTCTAGTGATAGTGG - Intergenic
1013040250 6:106425936-106425958 TCATGAATTTAAAGTGAAACTGG - Intergenic
1013609761 6:111783545-111783567 TCATTCATTTATGGTGATGCAGG - Intronic
1019646482 7:2132170-2132192 TCAAGCAATTATAGGTTTACAGG + Intronic
1020761533 7:12273056-12273078 TAATACAATTTTAGTTATACAGG - Intergenic
1020857267 7:13445273-13445295 TTATATAATTATAGAGATACAGG - Intergenic
1021827279 7:24567968-24567990 AGATGCAATTAAAGTGCTACAGG + Intergenic
1022433669 7:30356248-30356270 TCTTGCTTTTAGAGTGATACAGG + Intronic
1022777217 7:33539794-33539816 TAATGCAGTTAAAGTGTTACTGG - Intronic
1023273308 7:38490596-38490618 GCATGCATTTATAGTGAACCTGG - Intronic
1032227442 7:130044193-130044215 TCATGCATTTATATAGAGACAGG + Intronic
1034347072 7:150393068-150393090 TGATACTATAATAGTGATACGGG - Intronic
1034906532 7:154952787-154952809 TCAGGCAATTCTTGTCATACAGG - Intronic
1037099192 8:15022061-15022083 ACATGCAATCATAATGAGACAGG + Intronic
1037151487 8:15640681-15640703 TGGTGCTATTATATTGATACTGG + Intronic
1038093911 8:24286193-24286215 TCATTCTATTATAATGATACAGG + Intergenic
1038846121 8:31231031-31231053 TGATGCAATTATAGGACTACAGG + Intergenic
1042490063 8:69387069-69387091 TCATTCTATTATAAAGATACAGG + Intergenic
1042768152 8:72349455-72349477 TTTTGCTATTATGGTGATACTGG + Intergenic
1045140950 8:99281614-99281636 TGATGCAAATATGTTGATACTGG + Intronic
1048026102 8:130588369-130588391 TCATGCTATTCTTGTGATAGCGG - Intergenic
1048849876 8:138634783-138634805 CCATGCAATTAGAGTGATGTTGG - Intronic
1050827088 9:9960534-9960556 TCATGCTATCATATTGATACTGG - Intronic
1051128276 9:13830586-13830608 TCATGTATTTGTGGTGATACTGG - Intergenic
1051491411 9:17670403-17670425 ACATGCCATTATCATGATACAGG - Intronic
1052208048 9:25867525-25867547 TCATGAAATTATAGTGATGGTGG - Intergenic
1059043642 9:110841560-110841582 TCATTCTATTATAAGGATACAGG - Intergenic
1062556881 9:137117023-137117045 TCATGCAAAGATAGTGAAAATGG + Intergenic
1203631482 Un_KI270750v1:75546-75568 TCATGCCAGTAGAGTGAAACAGG - Intergenic
1185711221 X:2304878-2304900 TCATTCTATTATAAAGATACAGG + Intronic
1188481607 X:30641864-30641886 TCATTCTATTATAAAGATACAGG + Intergenic
1190292807 X:49003922-49003944 TCATGCAAATAGAATGAGACAGG + Intergenic
1193749978 X:85329394-85329416 TCATGCATTTATAATGGCACCGG + Intronic
1195014546 X:100765754-100765776 CAATGCAATCATAGTGATAGTGG - Intergenic
1196637972 X:118025559-118025581 TAGTGCAAGAATAGTGATACTGG + Intronic
1197533040 X:127654301-127654323 TCATTCTATTATAAAGATACAGG + Intergenic
1199048913 X:143211775-143211797 TCATGCTATTTTAGTGATTATGG + Intergenic
1199585971 X:149416081-149416103 TCATGAAAATATTGTGATACTGG + Intergenic
1199910013 X:152276048-152276070 TCATGCAATCATCTTAATACAGG + Intronic
1201451037 Y:14115670-14115692 TCATGCACTTAGAGTGAGAATGG - Intergenic