ID: 977757652

View in Genome Browser
Species Human (GRCh38)
Location 4:100692330-100692352
Sequence TTGTTCCAATGAAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977757652_977757653 -8 Left 977757652 4:100692330-100692352 CCTTTTTTCTTTCATTGGAACAA 0: 1
1: 0
2: 5
3: 56
4: 668
Right 977757653 4:100692345-100692367 TGGAACAAGTTTGTAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977757652 Original CRISPR TTGTTCCAATGAAAGAAAAA AGG (reversed) Intronic
901900205 1:12354614-12354636 ATGTAGCAATGTAAGAAAAAAGG - Intronic
901976356 1:12947393-12947415 TTGTTCATATGAAAAAAAAAAGG + Intronic
901996493 1:13155760-13155782 TTGTTCATATGAAAAAAAAAAGG + Intergenic
902008816 1:13254377-13254399 TTGTTCATATGAAAAAAAAAAGG - Intronic
902720232 1:18299266-18299288 CTGTTCAAATGAAAAAAATAAGG + Intronic
903756430 1:25664749-25664771 TTGTTCGATTAAAAGAAAAGGGG + Intronic
904745169 1:32706226-32706248 TCTATCCAATGAAAGTAAAAAGG + Intergenic
905030482 1:34880054-34880076 TTGTGTCAAAGAAAGAAAAGGGG - Intronic
905934064 1:41809805-41809827 GGGTTCAGATGAAAGAAAAAGGG + Intronic
906270964 1:44478410-44478432 TTATTCCATTCAAAAAAAAAAGG + Intronic
906589241 1:47008133-47008155 AAGTTGCAATGAAGGAAAAAAGG + Intergenic
906922990 1:50084624-50084646 TTGTTCCACGAACAGAAAAAAGG - Intronic
906992895 1:50757683-50757705 TTGTTACACTGAATAAAAAAGGG - Intronic
907079849 1:51611100-51611122 GTGTTCTAAGGAAAGAAAAGAGG - Intronic
907766362 1:57415552-57415574 TAGTTCCAATAAATGCAAAAAGG - Intronic
908052087 1:60244381-60244403 TTGTTTGAATTAAAGAATAAAGG + Intergenic
908438454 1:64130176-64130198 GCATTCCAATAAAAGAAAAAGGG + Intronic
908579916 1:65503908-65503930 TTGTTCCAATAAAAGGAACCAGG + Intronic
909319831 1:74270430-74270452 TAGAGCCAATGAAAGAAGAAAGG + Intronic
909342196 1:74544810-74544832 TTTTTCCATTGAAAGACAGATGG + Intergenic
909361526 1:74765221-74765243 TTTTTCTAATGAAAAGAAAAAGG + Exonic
909367197 1:74840376-74840398 GTGTTCAAATGGAACAAAAAAGG - Intergenic
909491400 1:76230715-76230737 TTCTTCTAATCAAAGAGAAAAGG - Intronic
909623266 1:77688506-77688528 ATGATCCAATGAAAGAAATTAGG - Intergenic
909933026 1:81520026-81520048 ATGTTCAAAGGCAAGAAAAAAGG - Intronic
910037200 1:82802682-82802704 TTTTTCCAAAGGAAGAAAGAGGG - Intergenic
910090963 1:83463641-83463663 TTGTTTCTATGGAAAAAAAAAGG - Intergenic
910200556 1:84693934-84693956 TTGTTCCATTGATAGAACACAGG - Intergenic
910208269 1:84769412-84769434 TTGGGCCAATGAAATATAAATGG - Intergenic
910255533 1:85243665-85243687 CTGTTGCAATGAAACAAAAGTGG + Intergenic
910441852 1:87261191-87261213 TTGTGCCTGTTAAAGAAAAAGGG - Intergenic
911436342 1:97864233-97864255 TTGATTAATTGAAAGAAAAAAGG + Intronic
912674375 1:111663723-111663745 TTTATTGAATGAAAGAAAAAAGG - Intronic
912765058 1:112401365-112401387 TTGGTCCAAGGAAAAAAGAAAGG + Intronic
912778283 1:112520816-112520838 TGGTGCAAAGGAAAGAAAAAAGG - Exonic
913998997 1:143676469-143676491 TTGTTGCATTAAAAGAAAACAGG - Intergenic
914249922 1:145913306-145913328 TTCTTACCATAAAAGAAAAAAGG + Intronic
915042133 1:152977453-152977475 TTCTTCCTATGAAAGAAAAAGGG - Intergenic
915405448 1:155656616-155656638 TGCTTCAAATGCAAGAAAAATGG - Intergenic
916624954 1:166545564-166545586 TTTTTTAAATGAAAGAACAAAGG - Intergenic
918214068 1:182377722-182377744 TTCTTCCAAAAAACGAAAAAAGG + Intergenic
919227140 1:194719386-194719408 TTTTTCTATTGAAAGAAACATGG + Intergenic
919848210 1:201655072-201655094 TTGTTCCAAAAGAAGAGAAATGG - Intronic
919989952 1:202702749-202702771 TTGGTACAATGAAAGATACATGG + Intronic
920463155 1:206157798-206157820 TTGTTTGAATGAAATAATAAAGG + Intergenic
921504059 1:215944725-215944747 TTGCTTAAATGAAAGAAATATGG + Intronic
921801282 1:219405440-219405462 TGTTTCCCTTGAAAGAAAAATGG + Intergenic
923294182 1:232577205-232577227 TTGTTCCAATGATAGAGCACGGG - Intergenic
923517671 1:234710841-234710863 TTAATCCAATGAATGAAAAATGG - Intergenic
923566038 1:235076703-235076725 TTGTTCTAAAGGAAGAAAGAAGG + Intergenic
923965829 1:239137829-239137851 TAGTTCCAAAGAAGGTAAAATGG - Intergenic
924455933 1:244218953-244218975 TTGTTGCAATCCAAGAAAATGGG - Intergenic
924786376 1:247203677-247203699 TGGTTTCAATGAAAAACAAAGGG + Intergenic
1062865970 10:854669-854691 TTGTTCCACTTAAAGAACACAGG + Intronic
1063111868 10:3045130-3045152 TTGTTCCAATACAATAAACATGG + Intergenic
1063212154 10:3890585-3890607 TTGTTCCAATCAAGGAAATTTGG - Intergenic
1063478182 10:6347000-6347022 TTATTCCAAGGAACAAAAAATGG - Intergenic
1064608569 10:17072355-17072377 TTTTGCCATTGAAAGAAAAAAGG + Intronic
1064736388 10:18385663-18385685 TTATTCAAATGACAGCAAAACGG + Intronic
1065098919 10:22314445-22314467 GTGTTCTAATGCTAGAAAAACGG - Intergenic
1065620560 10:27576795-27576817 TGTTTCCAATGAAAGCACAATGG + Intergenic
1065727468 10:28679522-28679544 TGGCTCCAATTAAAAAAAAAAGG + Intronic
1065878043 10:30013994-30014016 TTGTTGGAAAGAAATAAAAAGGG - Exonic
1066219523 10:33321554-33321576 TTCTTACATTTAAAGAAAAAAGG - Intronic
1066355478 10:34679531-34679553 TTCTTCCAGTGAATGAGAAATGG + Intronic
1067365223 10:45621298-45621320 TTATTACAGTGAGAGAAAAATGG + Intronic
1068031955 10:51715693-51715715 TTGGTGCAATCATAGAAAAATGG - Intronic
1069543641 10:69313947-69313969 TTGGGCAAATGAAAGAGAAAAGG + Intronic
1069650687 10:70045447-70045469 TTGTTCCAAAGGCAGATAAATGG + Intergenic
1071739460 10:88340653-88340675 TTGTAGAAATAAAAGAAAAAAGG + Intronic
1072204414 10:93190028-93190050 TTCTTTAAATGAAAGAAAAATGG - Intergenic
1072445041 10:95491782-95491804 TAGTTCCAAGAAAAAAAAAATGG + Intronic
1072786421 10:98286135-98286157 TGGTACCAATAAAAGGAAAAAGG + Intergenic
1072911049 10:99501544-99501566 TTGTACCAAAAAAAAAAAAAAGG + Intergenic
1073924436 10:108498713-108498735 TTTTTTCAATGAAGAAAAAATGG + Intergenic
1074530395 10:114293579-114293601 TCTTTTAAATGAAAGAAAAAAGG - Intergenic
1075081884 10:119389751-119389773 TTGTTCCAGTGTAGGAAACATGG - Intronic
1075363381 10:121860493-121860515 ATGTTTCCATGAAAGCAAAAAGG + Intronic
1075724656 10:124605099-124605121 TTGTACCAATCGAAGGAAAATGG - Intronic
1075917130 10:126177776-126177798 TTGTTGCAATGTAAGAAAGCAGG - Intronic
1076282358 10:129259028-129259050 TTGTGCCAAAGATAGAAGAACGG - Intergenic
1078599300 11:12716208-12716230 TGGTTCCAATGCAACAGAAAAGG - Intronic
1078827625 11:14945150-14945172 TGTTTCTCATGAAAGAAAAAAGG - Intronic
1079666202 11:23109103-23109125 TTGTTCAAATTAAAAATAAAAGG + Intergenic
1079934439 11:26600174-26600196 TAGTTCCAGAGAAAGAAAACTGG - Intronic
1080112961 11:28589704-28589726 TTGTTTAAATAAAAAAAAAAAGG + Intergenic
1080192229 11:29564790-29564812 TTGTTCCAATGAAAATGAAATGG + Intergenic
1080220137 11:29893459-29893481 TTGTCCCCATTAAAAAAAAAAGG + Intergenic
1080704720 11:34679621-34679643 TTGTTCCAATGAAATTATATAGG - Intergenic
1080989071 11:37508240-37508262 ATGTTCCCATGAAAGATAAAGGG - Intergenic
1081431420 11:42980459-42980481 TTCTTCGAATGAGAGAGAAATGG - Intergenic
1081432518 11:42991569-42991591 GTGTTATAATTAAAGAAAAAAGG - Intergenic
1081475458 11:43425685-43425707 TACTAACAATGAAAGAAAAAAGG - Intronic
1082208785 11:49471234-49471256 TTATTCCTATGAGAGTAAAAAGG - Intergenic
1082622635 11:55442566-55442588 TGGTAAAAATGAAAGAAAAAGGG - Intergenic
1082752637 11:57036375-57036397 TTGTTCTCTTGAAAAAAAAAAGG - Intergenic
1082995017 11:59246864-59246886 TGATTCCAAGGAAAGAAAAGGGG + Intergenic
1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG + Exonic
1083448101 11:62724112-62724134 TTTTTCCAATAAATGAGAAAGGG + Intronic
1084365426 11:68694415-68694437 TTATTTCAATGCAAAAAAAAAGG + Intergenic
1085371311 11:76008346-76008368 TTCTTAGAATGAATGAAAAAAGG + Intronic
1085382246 11:76130630-76130652 TTGTTACTTTAAAAGAAAAATGG - Intronic
1086510579 11:87553703-87553725 TATTTGCAAAGAAAGAAAAATGG - Intergenic
1086640833 11:89153969-89153991 TTATTCCTATGAGAGTAAAAAGG + Intergenic
1087548877 11:99620975-99620997 TTGTTTGAATGAAAAAAAATAGG - Intronic
1088334440 11:108687878-108687900 TGTTTACAGTGAAAGAAAAAAGG - Intronic
1088845913 11:113667166-113667188 ATGTTACAATAAAAGTAAAAGGG - Intergenic
1088902221 11:114126992-114127014 CTGCTCCAATGAAAGAAGAAAGG - Intronic
1089543238 11:119203719-119203741 CTGTTTCAAAGAAAAAAAAAAGG + Intergenic
1090790233 11:130086313-130086335 TTTTTCCAAAGATATAAAAATGG - Intronic
1090882797 11:130849006-130849028 ATGTACCCATGAAAGAAAAGAGG - Intergenic
1091418755 12:315747-315769 TTGTTCAAATGAGTGAAAGATGG + Intronic
1092852623 12:12644479-12644501 TTTTCCCAAAGAAAGAAAAGGGG + Exonic
1093370910 12:18363978-18364000 TTGATTCTATGAAAGAAAAAGGG - Intronic
1093398901 12:18718532-18718554 ATGTTTAAATGAGAGAAAAATGG - Intronic
1093485129 12:19643745-19643767 TTCTTGCAATTAAAAAAAAAAGG - Intronic
1094161968 12:27400594-27400616 TTGTTGGAATGGAAGAAGAAAGG + Exonic
1094359396 12:29613666-29613688 TTGATGAAATGGAAGAAAAAAGG + Intronic
1094565169 12:31591936-31591958 TTTTTCCTTTGAAAGAAAACTGG + Intergenic
1095304439 12:40622962-40622984 TTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1095370155 12:41457659-41457681 TTGTACCAATGTCAGAAACATGG + Intronic
1095381526 12:41599828-41599850 TTATTCCAATGAAAGCAAGAAGG - Intergenic
1095505408 12:42892051-42892073 TTGTTTTAATTAAAGAAAAGAGG - Intergenic
1095581920 12:43810052-43810074 ACTTTCCAATGAAAGAAACAGGG + Intergenic
1095920879 12:47529063-47529085 TTATTCCAAGGATACAAAAATGG - Intergenic
1096366888 12:51035668-51035690 TTGTTTCAATGTAGAAAAAAAGG - Intergenic
1096383842 12:51181387-51181409 TTGTTCCCATGAAGGAATATTGG + Intergenic
1096400946 12:51305753-51305775 TTGGTCAAATCAAAGAAAACTGG + Intronic
1097386371 12:58954371-58954393 TCATTCAAATGAAACAAAAAAGG - Intergenic
1097621001 12:61939696-61939718 ATTTTCAAATGAAAGAAAACAGG + Intronic
1097881523 12:64690838-64690860 TTTTTTAAATGAAAAAAAAAAGG - Intronic
1098143523 12:67475011-67475033 TTTTTTAAAAGAAAGAAAAATGG + Intergenic
1098505182 12:71241132-71241154 TTGCTCCAAGGAAAGAATGATGG + Intronic
1098878201 12:75889179-75889201 TTGTTTCAAAGAAAGTAACAGGG - Intergenic
1099791506 12:87340967-87340989 TAGTTCCAAGAAAAAAAAAAAGG + Intergenic
1100357161 12:93842301-93842323 TTATTCCAGTGAAAGCAATAAGG + Intronic
1100460743 12:94796907-94796929 ATGTTACACTTAAAGAAAAAAGG + Intergenic
1100469826 12:94880476-94880498 TAGTTCCAATGTAACCAAAATGG - Intergenic
1100540442 12:95552480-95552502 TTCTTAGAATTAAAGAAAAAAGG - Intergenic
1101038973 12:100735187-100735209 TTGGTACAATGAATGAGAAAAGG - Intronic
1101939560 12:109089914-109089936 TTGTACCAATGAACCAAATAGGG + Intronic
1102942029 12:116951536-116951558 TTGTGCAAAAGAAAGAGAAAAGG - Intronic
1103143130 12:118569139-118569161 TGGTCCAAATGAAAGAAAAAAGG - Intergenic
1103667498 12:122581497-122581519 TTGTCTCAAAAAAAGAAAAAAGG - Intronic
1103685110 12:122726096-122726118 TTATTACAATGAAGGAACAAAGG + Exonic
1103906239 12:124328530-124328552 TGGTTCACAAGAAAGAAAAAAGG - Intronic
1104044515 12:125152401-125152423 TTGTGGCAGTTAAAGAAAAACGG + Intergenic
1105485410 13:20825488-20825510 TTGTTCAAATAAAGCAAAAAAGG + Intronic
1106205419 13:27589029-27589051 TGGATTCAATGAAAGAAAAGGGG + Intronic
1106206340 13:27599334-27599356 TTGTTCCAATGAGTAAACAAAGG - Intronic
1106294462 13:28398028-28398050 TTCTTCCAAAGAAAAAAAATTGG + Intronic
1106801428 13:33260308-33260330 TATTTGCAATGAAAGAGAAAGGG + Intronic
1107969327 13:45626073-45626095 CTGTTCAAATGAAAGTTAAAAGG - Intergenic
1108133139 13:47325211-47325233 TTTTCCAAATCAAAGAAAAATGG - Intergenic
1108888374 13:55220553-55220575 TTGATCTAAAGAAAGAAAAACGG - Intergenic
1109044047 13:57384830-57384852 ATATTCCAATAAAAGAAAATGGG - Intergenic
1109430338 13:62224654-62224676 TTGTTACCACCAAAGAAAAAAGG + Intergenic
1109742924 13:66579482-66579504 ATATTCCAATGGTAGAAAAATGG + Intronic
1109776224 13:67044228-67044250 TTGTTCAATCGAGAGAAAAATGG + Intronic
1109986098 13:69987516-69987538 TAGGTCAAAGGAAAGAAAAAAGG + Intronic
1110033647 13:70652298-70652320 TTATTCTATTGAATGAAAAATGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110608344 13:77460225-77460247 TTTTTCTAATTAAAAAAAAAGGG + Intergenic
1110622172 13:77609136-77609158 TGGTTACTATGAAACAAAAAAGG - Intronic
1110673643 13:78211741-78211763 TGGTTCTAATGAAAGAAAGGAGG + Intergenic
1110747448 13:79070890-79070912 TTCTTGCAATTAAAAAAAAAGGG - Intergenic
1110860195 13:80339399-80339421 TTCTTAAAGTGAAAGAAAAATGG + Exonic
1111422296 13:88028643-88028665 TTGTTTCAAGGACAGACAAATGG - Intergenic
1111441772 13:88291066-88291088 TTGTTTAAATCACAGAAAAAGGG + Intergenic
1111442161 13:88293898-88293920 TTGTTTAAATCACAGAAAAAGGG - Intergenic
1111700197 13:91677167-91677189 TCTTTCAAATGAAAGAAAAAGGG + Intronic
1111749132 13:92305454-92305476 TTGATCCAATTTAAAAAAAAGGG - Intronic
1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG + Intergenic
1112291858 13:98150903-98150925 TTTTTGAAATGAATGAAAAATGG + Intronic
1113155491 13:107315801-107315823 TTCTTCCAAGGTAATAAAAATGG + Intronic
1113157823 13:107345184-107345206 GTCTTCCAATGCAAGAACAAAGG - Intronic
1114209482 14:20602929-20602951 TTGTACCAGTGAACAAAAAAGGG + Intronic
1114343846 14:21774332-21774354 TTGTTTCAAAGAATGAAAATTGG + Intergenic
1115544385 14:34452312-34452334 TTGTTTCAATGTAAGAAAACTGG - Intronic
1115562319 14:34594307-34594329 TTGTTTCAAAAAAAAAAAAAAGG - Intronic
1116505660 14:45676935-45676957 GTGAACCAAAGAAAGAAAAATGG - Intergenic
1117687048 14:58264268-58264290 GTGTTCCAAAGAAAGAATATAGG - Intronic
1117828279 14:59726208-59726230 GTCTTCAAATGCAAGAAAAATGG - Intronic
1118101903 14:62615221-62615243 TTATTCCACTGAAACATAAATGG - Intergenic
1118580111 14:67287343-67287365 TTGTTCTGATATAAGAAAAAAGG + Intronic
1118813949 14:69295753-69295775 TGGTTTCGATGAAAGAACAATGG - Intronic
1119074511 14:71622680-71622702 TGTTTATAATGAAAGAAAAAAGG + Intronic
1119147775 14:72332402-72332424 TGGAACCAATGAGAGAAAAAGGG + Intronic
1119375839 14:74192087-74192109 ATCTTCCAATGCAAGATAAATGG - Intronic
1119885357 14:78135910-78135932 TAGATCCCAAGAAAGAAAAAGGG - Intergenic
1120042085 14:79765362-79765384 TTGTTCCATTGAAAGAGAACTGG - Intronic
1120401684 14:84040617-84040639 TTGATCAAGTGGAAGAAAAAAGG - Intergenic
1120660406 14:87241778-87241800 TTTGTGCAAAGAAAGAAAAAGGG + Intergenic
1120694389 14:87628241-87628263 TTGCTGCAAGGAAAGGAAAAGGG - Intergenic
1120834098 14:89025469-89025491 CTGTTCAAGAGAAAGAAAAAAGG - Intergenic
1121660959 14:95634721-95634743 TTTCTCCAATGAAGGAACAATGG + Intergenic
1125244786 15:37622245-37622267 TTCTTCCCATCAAAAAAAAAGGG + Intergenic
1125416825 15:39462549-39462571 TTGTCCAAAAGAAATAAAAATGG - Intergenic
1125452667 15:39825195-39825217 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1125541621 15:40472867-40472889 TTTTTCCAAGGAAAGGAAAACGG + Exonic
1125868785 15:43078296-43078318 ATGTGGCAATGAAGGAAAAAGGG + Intronic
1126085468 15:45007173-45007195 TTTTTCTAAAGAAACAAAAAAGG + Intergenic
1126337364 15:47601446-47601468 ATTTTCTAATGAAATAAAAAAGG - Intronic
1126549980 15:49918182-49918204 TGTTTCCTATGAAAGAAAAGGGG - Intronic
1126620348 15:50632808-50632830 TGTTTTGAATGAAAGAAAAATGG + Intronic
1126623340 15:50662320-50662342 CTGTTCCAAAAAAAAAAAAAAGG + Intronic
1126921769 15:53534552-53534574 TTGAACTAATGAAACAAAAATGG - Intronic
1127306730 15:57713296-57713318 TTAATGCACTGAAAGAAAAATGG - Intronic
1127651794 15:61016115-61016137 TGGTACTAATGAGAGAAAAAGGG - Intronic
1127731858 15:61809091-61809113 CTATTTCAATGAAAGAAAGAGGG - Intergenic
1127887912 15:63219758-63219780 TTTTTTCCATGAAAGAAAACTGG + Intronic
1128051859 15:64671841-64671863 TTGTTCCCATGAAACAAAGATGG + Intronic
1128487389 15:68107604-68107626 TTTTTCAAATGAAAGTATAAGGG - Intronic
1129064753 15:72892399-72892421 TAGTTGCAATGAAGAAAAAAAGG - Intergenic
1130045393 15:80440361-80440383 TAATTCCAATGGAAGAAAAGTGG - Intronic
1130751013 15:86713159-86713181 TTCTTCCACTGAAAGAGAAAGGG + Intronic
1131241964 15:90752916-90752938 TTGATACAATGAATGACAAATGG + Intronic
1131682154 15:94735117-94735139 CTGGTCCAATGATAGAAACATGG + Intergenic
1132171294 15:99659014-99659036 TTTGTTGAATGAAAGAAAAAAGG + Intronic
1132867632 16:2101660-2101682 CAATTCCAATGAAAGGAAAATGG + Intronic
1134395247 16:13856460-13856482 TTGGTCCAGTGAGAGGAAAAGGG - Intergenic
1135749685 16:25047151-25047173 CTGTCCCAAAAAAAGAAAAAAGG + Intergenic
1135912838 16:26577133-26577155 TTGTTTCAAAGGAAGCAAAAAGG - Intergenic
1137305473 16:47195290-47195312 TTCTTCCAGTGAAACAATAATGG - Intronic
1137416234 16:48283529-48283551 TTGTTCCATTTACAGAACAAAGG - Intronic
1137485393 16:48886219-48886241 TTTTAACAATGTAAGAAAAAGGG - Intergenic
1137831409 16:51546647-51546669 TTGTTTCAAGGAGAGAAAGAAGG - Intergenic
1137859088 16:51828351-51828373 TTGTTCCAGGTAAAGAAAATAGG - Intergenic
1138133910 16:54504865-54504887 TTGTGACAATGAAGGAAAAAGGG + Intergenic
1138327240 16:56184996-56185018 ATGAGGCAATGAAAGAAAAAGGG - Intergenic
1138698063 16:58834176-58834198 TTGTTTCAGTGAAATAAACAGGG - Intergenic
1138742138 16:59323322-59323344 TTGTTGCAATGAAGGAAAAGTGG - Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1139819085 16:69705614-69705636 ATGTTTAAATGAAAGGAAAAAGG + Intergenic
1139843696 16:69903466-69903488 TTTTTGGAATAAAAGAAAAATGG + Intronic
1139903837 16:70348937-70348959 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1139960235 16:70713438-70713460 TTCTTCCAATTAAAGTACAAAGG + Intronic
1141216585 16:82031021-82031043 TTATTTCAAAGATAGAAAAAAGG + Intergenic
1141565374 16:84898094-84898116 TTATTACAGTGAAAGAAAAAAGG - Intronic
1142568905 17:859480-859502 TTATTCAAAAGAAAAAAAAATGG + Intronic
1143395566 17:6592874-6592896 TTTTTCCCATGGAAAAAAAATGG - Intronic
1143852993 17:9826689-9826711 TTTTTGTAATGAAAGGAAAAAGG - Intronic
1144226111 17:13148462-13148484 TAGATCTGATGAAAGAAAAACGG + Intergenic
1144506427 17:15835082-15835104 TTCTTCCAATGACAGACAATAGG - Intergenic
1145099417 17:20061739-20061761 TTGAATAAATGAAAGAAAAATGG - Intronic
1145118481 17:20233842-20233864 TTCTTCCAATGACAGACAATAGG - Intronic
1145170603 17:20653015-20653037 TTCTTCCAATGACAGACAATAGG - Intergenic
1145201419 17:20948595-20948617 TTCTTCCAATGACAGACAACAGG - Intergenic
1146010914 17:29193798-29193820 ATTTTCCAAGGAAAGAATAATGG - Intergenic
1146237551 17:31181964-31181986 TTGCTCCAAGGAAAGGAAGAGGG - Intronic
1146717020 17:35094972-35094994 TGGAGCCACTGAAAGAAAAATGG - Intronic
1147126435 17:38372804-38372826 CTGTTGTAATAAAAGAAAAAAGG + Intronic
1147803048 17:43108329-43108351 TTGTGCCAAAAAAAAAAAAAAGG + Intronic
1148939288 17:51194122-51194144 TTCTTGCAAGGAAAGAAAACTGG + Intronic
1148968650 17:51459469-51459491 TTTTTAAAATGAAGGAAAAATGG - Intergenic
1149523935 17:57339639-57339661 ATGTCCCAAAGAATGAAAAATGG - Intronic
1149627939 17:58093137-58093159 TTGCTCAAATGAAAAAAGAAGGG + Exonic
1149916292 17:60613204-60613226 TAGTCCAAATGAAAAAAAAAAGG - Intronic
1150058821 17:62046266-62046288 CTTTTCCAAAGAAGGAAAAAGGG + Intronic
1150678327 17:67263977-67263999 GTGTTCCAACGCAAGATAAAAGG - Intergenic
1151050830 17:70977697-70977719 TTCTTCCATTAAAAGAGAAAAGG + Intergenic
1151069468 17:71191948-71191970 TTCTTCCAATTCAAGAATAAGGG + Intergenic
1152526988 17:80893973-80893995 CTGTTCAAAAGAAAGAATAAAGG + Intronic
1152998706 18:433231-433253 TTTTTCCTATGAGGGAAAAAAGG + Intronic
1154093117 18:11383459-11383481 TTTTTCCATTAAAAAAAAAATGG - Intergenic
1154243335 18:12672545-12672567 TTATCACAATGAAAGAAAAAAGG + Intronic
1155038209 18:22043018-22043040 TTGTTCTAAAGAAGGAAAGAGGG - Intergenic
1155082429 18:22424010-22424032 TTGTGCTAATAAAAGAATAAGGG - Intergenic
1155277899 18:24207028-24207050 TGGAGCCAAAGAAAGAAAAACGG + Intronic
1155449103 18:25944767-25944789 TTTTTCCAATGATAAAAAAATGG - Intergenic
1155572411 18:27210403-27210425 TTTTTAAAATAAAAGAAAAAAGG + Intergenic
1155683838 18:28522139-28522161 TTAGTCCACTCAAAGAAAAAAGG + Intergenic
1156437101 18:37143797-37143819 TGGTACCACTAAAAGAAAAAAGG - Intronic
1157017705 18:43737799-43737821 CTGTGCCAATGAAAGTGAAACGG - Intergenic
1157427738 18:47598545-47598567 TTTTACCAAGGGAAGAAAAATGG + Intergenic
1157649198 18:49310830-49310852 TTGTTCAATTGAAACAATAAGGG + Intronic
1157741812 18:50100122-50100144 TTGGTCCAATGACAGAAGGAAGG + Intronic
1157754891 18:50209036-50209058 GTGATACAATGAAAGAGAAATGG - Intergenic
1158042147 18:53107515-53107537 TTGATCCAAAAAAAAAAAAAAGG + Intronic
1159389106 18:67765494-67765516 TTGTTCAAGTGAATGAAATATGG - Intergenic
1159532164 18:69668919-69668941 TTATTAAAATGACAGAAAAAGGG - Intronic
1159753685 18:72336117-72336139 TTCTTCAATTGAAAGCAAAAAGG - Intergenic
1161209441 19:3058572-3058594 TTGTCCCAGCTAAAGAAAAAAGG - Intronic
1162151004 19:8645620-8645642 TTGCTCCCAAGAAAGAAAAAGGG - Intergenic
1163475952 19:17526306-17526328 CTGTCCCAAAGAAAAAAAAAAGG + Intronic
1166286056 19:41829555-41829577 TTGTTCCAGGAAAAGCAAAAAGG + Intergenic
1166495746 19:43301890-43301912 TCATTCCCATGAAAGAATAAAGG - Intergenic
925474895 2:4202485-4202507 GTTTTCCCATGAAACAAAAAAGG - Intergenic
925521444 2:4750273-4750295 TTGTTGCAAGGAAACCAAAATGG - Intergenic
925566173 2:5256985-5257007 TTGCTAAAAGGAAAGAAAAATGG - Intergenic
925764803 2:7222000-7222022 CATTTTCAATGAAAGAAAAATGG + Intergenic
926677381 2:15637546-15637568 TTGCTCAGATGAAAAAAAAAGGG - Intergenic
926811923 2:16763008-16763030 TTGTTTTATTGAAAGATAAATGG + Intergenic
926894915 2:17675482-17675504 ATCTTCAGATGAAAGAAAAATGG - Intronic
926961783 2:18365134-18365156 ATGTTGCAATAAAAAAAAAAGGG + Intergenic
928376524 2:30778900-30778922 TTCCTCCAATGCAAGAAAGAGGG + Intronic
928615451 2:33034222-33034244 TTGTTCTAAAAAAAAAAAAAAGG + Intronic
929068613 2:38006364-38006386 CTGCTCCAATGAAATAAAAGAGG - Intronic
929097373 2:38276717-38276739 TTGTTCCACTTACAGAAAACAGG + Intergenic
929152211 2:38757674-38757696 TTTTTCTAATGAAGGAATAAAGG + Intronic
929219147 2:39445415-39445437 TTGTATCAATGAAACAAAAGAGG + Intergenic
929678635 2:43965721-43965743 TTTTTCCAAAGACATAAAAATGG + Intronic
929757846 2:44782543-44782565 TTGTTCCATTGACAGAACACAGG - Intergenic
930109446 2:47666089-47666111 TCCTTGCAAAGAAAGAAAAATGG + Intergenic
930267158 2:49213368-49213390 CTGTTCCAATAAAAAAAAGAGGG + Intergenic
930317002 2:49810006-49810028 TTATCCCCATGAAAGAAAATGGG - Intergenic
930695370 2:54406484-54406506 TTGTTATAAAGAAATAAAAAGGG + Intergenic
930737528 2:54794645-54794667 TTACTCCACTGAAAGGAAAAAGG - Intronic
930863532 2:56099762-56099784 TTCCTGCTATGAAAGAAAAAAGG + Intergenic
931085330 2:58823766-58823788 TTTTTTTAATGAAGGAAAAAAGG + Intergenic
931659553 2:64546192-64546214 TTGTTACCATTAAAAAAAAAAGG - Intronic
931777250 2:65551166-65551188 TTGTTCCAATGAAGCAGAAATGG - Intergenic
932074335 2:68649097-68649119 TAATTTCAATGAAAGCAAAAAGG - Intronic
932320694 2:70820214-70820236 TAGTTTGAATGAAAGAAGAAAGG + Intronic
932716933 2:74107588-74107610 GTATTCCAATTAAAGAAACAAGG + Exonic
932738862 2:74276367-74276389 TTTTTGGAATGAAAGAAGAAAGG + Intronic
934053772 2:88234095-88234117 TTGTTTCAATTAAAAAACAATGG + Intergenic
934942550 2:98513026-98513048 TTGTTTGAAAGAAAAAAAAATGG + Intronic
935148060 2:100409694-100409716 TTGTTCCTGTGGATGAAAAATGG - Intronic
935320126 2:101878572-101878594 ATGTTCACATGAGAGAAAAAAGG - Intronic
935500894 2:103836999-103837021 TTGGTCCAATGCAAGAGGAAAGG + Intergenic
936766353 2:115853504-115853526 TGGCTGCAATGAAAGAAACATGG - Intergenic
936964153 2:118110684-118110706 TTTTTTCAATGAAAGAAAATGGG + Intronic
937002801 2:118483610-118483632 TTGTTTCAATGAAAAGAATATGG + Intergenic
937348631 2:121144248-121144270 TTGGTCAAAGGAAAGAGAAAAGG - Intergenic
937716202 2:125036505-125036527 TTAACCCAATCAAAGAAAAAAGG - Intergenic
937756617 2:125547048-125547070 CTGTTTCAAAGAAAGAAAGAAGG - Intergenic
938193779 2:129307535-129307557 TTGTTCGCATGAATGTAAAATGG + Intergenic
938838584 2:135135572-135135594 TTGTTGTATTGAAAGAAAGAAGG + Exonic
939848337 2:147274644-147274666 TTGTTGGCATGAGAGAAAAAAGG - Intergenic
939879818 2:147617681-147617703 TTGTTCTCAGGATAGAAAAAAGG + Intergenic
940002826 2:148983887-148983909 GTGTTTGAATGAATGAAAAAAGG + Intronic
940138710 2:150469106-150469128 ATGATCCAAGGAGAGAAAAAAGG - Exonic
940149745 2:150586397-150586419 CTGTGCCAATAAAAGAAAAAAGG - Intergenic
940432600 2:153610866-153610888 TTGTTTCAATGAAAGAAAGAAGG + Intergenic
940512394 2:154634354-154634376 TTGTTCAAAACAATGAAAAAAGG + Intergenic
941381446 2:164797715-164797737 TTCTTCCAAGAAAAGCAAAAGGG + Intronic
941386772 2:164862179-164862201 TTGTTCTAAAGTATGAAAAAAGG + Intergenic
941598834 2:167513413-167513435 TTGTTCACATTAAAGCAAAATGG - Intergenic
942009401 2:171744266-171744288 TTTTTCCAAAGAATGTAAAAGGG + Intronic
942241493 2:173966345-173966367 ATGTTCCAATGGGGGAAAAAAGG - Intergenic
942378743 2:175364731-175364753 TTGTTCAGAGGAAAGAACAAAGG - Intergenic
943118758 2:183708236-183708258 ATGAACCAATAAAAGAAAAAAGG - Intergenic
943225938 2:185176031-185176053 TTTTTCAAATGAAATATAAATGG - Intergenic
943613121 2:190058182-190058204 ATTTTCCAGTGAAAGAATAAAGG - Intronic
944558392 2:200910286-200910308 TTTTTCTTAGGAAAGAAAAAAGG - Exonic
945005805 2:205404668-205404690 TTTTTTAAAGGAAAGAAAAAAGG - Intronic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
945426226 2:209707138-209707160 TTGTTGCTATAAAAGCAAAATGG + Intronic
945491186 2:210457332-210457354 GTGTCCTAATGACAGAAAAAAGG + Intronic
945593343 2:211762092-211762114 GTGTTGCGATGGAAGAAAAAGGG - Intronic
945707380 2:213252525-213252547 TTGTTCCAATCAAAAAAATAGGG + Intergenic
1169157640 20:3346645-3346667 TTGTGCAAATGAAATAGAAAAGG + Intronic
1169636330 20:7696145-7696167 TTTTTTCCATGAAAGAATAATGG - Intergenic
1169721383 20:8680832-8680854 TTATTCCAATGAGATAATAAAGG + Intronic
1170323014 20:15122157-15122179 TTATTACATTGAAAGAAAAGAGG - Intronic
1170336876 20:15280009-15280031 TTGTTGAAATGAAAGAAGCAAGG + Intronic
1170485389 20:16810504-16810526 TTGTTTTAAGGAAAAAAAAACGG + Intergenic
1170598147 20:17820928-17820950 TTGTTCCAAAGATGGAAACAAGG + Intergenic
1170915518 20:20620719-20620741 GTGTTCCAAGGAAAGTGAAATGG - Intronic
1171944285 20:31362607-31362629 TGTTTCAAGTGAAAGAAAAAAGG + Intergenic
1172928001 20:38558240-38558262 TTATAACAATGAAAGAAAATAGG + Intronic
1174242039 20:49144651-49144673 TGGGTTCAATGAAAGCAAAAAGG + Intronic
1174994951 20:55555991-55556013 TTGGTCCAATTAAATAAAACTGG - Intergenic
1175115800 20:56681009-56681031 TTATTTTAAAGAAAGAAAAAAGG - Intergenic
1175538499 20:59732749-59732771 TTGATCCCATGATACAAAAATGG - Intronic
1176022079 20:62967075-62967097 TTGTCCCGCTGAAAGGAAAATGG - Intronic
1176690826 21:9906437-9906459 TTCTTCCCATGTCAGAAAAAAGG + Intergenic
1177219465 21:18172569-18172591 TTATTCCATTAAAAAAAAAATGG - Intronic
1177415675 21:20790138-20790160 ATGTTCCAATTAGAAAAAAAAGG - Intergenic
1178182287 21:30175708-30175730 TTGTTAAAAAGAAAAAAAAATGG - Intergenic
1178355536 21:31908200-31908222 TTGTTCCAAGAAAAAAAAAGTGG + Intronic
1178678997 21:34655936-34655958 TTGATTGAAAGAAAGAAAAAAGG - Intergenic
1178753636 21:35327174-35327196 TTATTATAATGAGAGAAAAAAGG - Intronic
1179061672 21:37984930-37984952 TTGTCCCAATGCGAGAAAAGGGG + Intronic
1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG + Intronic
1180721704 22:17914169-17914191 TTTTTTGAAGGAAAGAAAAATGG + Intronic
1182384355 22:29923542-29923564 TTGTTCCAAAGAAGCACAAAAGG - Intronic
1184619615 22:45666296-45666318 TTTTACAAATGAAAAAAAAAAGG + Intergenic
1185203744 22:49524423-49524445 TTTTCACAATGAATGAAAAAGGG + Intronic
949116759 3:335657-335679 TTCGTCCAATGATGGAAAAAGGG + Intronic
949153601 3:800669-800691 TTTTTCCTATGAAGGAGAAAAGG - Intergenic
950220238 3:11189943-11189965 CTGTTTCAAAAAAAGAAAAATGG + Intronic
951160629 3:19416487-19416509 TTGAACTAATGAAACAAAAATGG - Intronic
951574071 3:24095644-24095666 ATGTTCCAATTAACAAAAAAAGG - Intergenic
951921992 3:27865197-27865219 TTATTCCAATCAAAGAATATAGG + Intergenic
951989472 3:28660372-28660394 TTGTGCTCATGAAAGACAAAAGG - Intergenic
952114929 3:30167626-30167648 TTGTTCCATTTATAGAACAATGG - Intergenic
952701143 3:36328958-36328980 TTATTCAAAAGAAAGAAGAAGGG + Intergenic
952715359 3:36474441-36474463 TTCTTCCACTGAAAGTGAAAGGG - Intronic
953422184 3:42762716-42762738 TTATTACAATGAAAGAATACGGG - Intronic
953438126 3:42896123-42896145 TTGTTTCTGTGAAAGAACAAAGG + Intronic
953528500 3:43715755-43715777 ATGTTTCAAAAAAAGAAAAAAGG + Intronic
953856957 3:46506526-46506548 ATCAGCCAATGAAAGAAAAATGG + Intergenic
954193469 3:48981325-48981347 TTGTTTCAAAAAAAAAAAAAAGG + Intronic
954319537 3:49822305-49822327 TTGTTTCAAAAAAAAAAAAAAGG - Intergenic
954843799 3:53536201-53536223 CTTTTGCAAAGAAAGAAAAAAGG - Intronic
955204518 3:56883595-56883617 TTCTTCTAATGAAAAGAAAAAGG - Intronic
955226759 3:57066568-57066590 TTGTTCAGAAGAAAGGAAAAAGG - Intronic
955427199 3:58804280-58804302 TTGTTTCAATAAAAGGAGAAAGG - Intronic
955448851 3:59045343-59045365 ATGTTCTAATGAATGAAAGAAGG + Intronic
955514032 3:59709024-59709046 TTATCTAAATGAAAGAAAAAGGG + Intergenic
955756701 3:62232076-62232098 TTGGTTCATTGAAAGTAAAAAGG - Intronic
955935972 3:64102768-64102790 TTGGTCAACTGAAAAAAAAATGG + Intronic
956577042 3:70763533-70763555 TTGTTCAAAAGAAAGCAAAAAGG + Intergenic
956716159 3:72081774-72081796 TTTTCCCAAAGAAAGATAAAGGG + Intergenic
957417496 3:79924836-79924858 TTTTTGAAATGAAAGAAAATTGG + Intergenic
958554159 3:95652694-95652716 TTCTTCAAATAAAACAAAAAAGG + Intergenic
958878523 3:99642685-99642707 TTTTTCCAGGGAAAGAACAAAGG - Intronic
959607116 3:108253346-108253368 TTTCTCCAATAAAAGAAACAGGG - Intergenic
960003495 3:112757597-112757619 TTCTTCAAAAGAAAGCAAAAGGG - Intronic
960104279 3:113777260-113777282 GTGTTCCACTAAAAGAAAAAAGG + Intronic
960190329 3:114696742-114696764 TTACTCCAATGAAAGAAAAGGGG + Intronic
960336562 3:116424873-116424895 TAGTTGAAAGGAAAGAAAAATGG - Intronic
961523477 3:127481947-127481969 TTTTTCAACTTAAAGAAAAAAGG - Intergenic
962130630 3:132670181-132670203 ATGTTCCTAAGAAGGAAAAAGGG - Exonic
962936417 3:140085236-140085258 TTGCTGCACTGAAAGAAAGATGG + Intronic
962986086 3:140537375-140537397 TTCTAGCAATGAAAAAAAAATGG + Intronic
963317988 3:143781320-143781342 TTGTTTCAATAAAAGTAAATTGG + Intronic
963693812 3:148539303-148539325 TTCTTCCAGTAACAGAAAAATGG + Intergenic
963752172 3:149193239-149193261 TTGTTCCCATGAAGTAAAAATGG + Intronic
963785864 3:149533750-149533772 TTGTTCACCTGAAAAAAAAAAGG + Intronic
963882994 3:150548910-150548932 TTGTTCTAGTGAAAGAAAAATGG - Intronic
964281282 3:155069088-155069110 TTCTACAAATGAAAGGAAAAGGG + Intronic
965485635 3:169274971-169274993 TTGAGCCAAAGAAAGAATAAAGG - Intronic
965711547 3:171560562-171560584 TTATTTTAATGAATGAAAAAAGG + Intergenic
966258097 3:177942473-177942495 TTGTTCCAAAAAAAAAAAGAAGG - Intergenic
966575716 3:181500302-181500324 TTGTTACAAAGAAGGAAGAAAGG + Intergenic
967462935 3:189767235-189767257 TGGTTCAAATAAAATAAAAAAGG - Intronic
967628561 3:191715208-191715230 TTTTTCCAATAAAAGATAAGAGG - Intergenic
968026959 3:195450602-195450624 TTCTTCCAAAGACAGAAGAATGG - Intergenic
968263802 3:197346606-197346628 TCGATCCAATGAGAGAAAAAAGG + Intergenic
968271731 3:197408281-197408303 TAGTTTAAATCAAAGAAAAATGG - Intergenic
969393546 4:6906677-6906699 TTGTTCCCCTGCAAGGAAAATGG - Intergenic
969937885 4:10700771-10700793 TTCATACAATGAAAGAAACATGG + Intergenic
970007144 4:11422476-11422498 TTATTACCATGAAAGAAAGAAGG + Intronic
970067107 4:12110588-12110610 GTGATACAATAAAAGAAAAAAGG - Intergenic
970273876 4:14376297-14376319 TTGTGCCAAGGAGAGAAAAAAGG - Intergenic
970342657 4:15122525-15122547 TTGTTCCAAGTAAAGAAAACAGG - Intergenic
970781047 4:19738302-19738324 TTGTTTCACTGATAGAAAACTGG + Intergenic
970945659 4:21688596-21688618 GGGTTCCAAGGAAAGAAAATAGG + Intronic
970980276 4:22087988-22088010 TCATTTCAATGAAAGAAATAAGG - Intergenic
971242222 4:24899201-24899223 TTGTTCCAAAGCCAGAAAGATGG + Intronic
971597151 4:28545046-28545068 TTATTCCATAAAAAGAAAAATGG + Intergenic
971828065 4:31653051-31653073 TTCTTCCAAAGAAAGAACAAAGG + Intergenic
972148723 4:36062960-36062982 TTGTACACATGACAGAAAAATGG + Intronic
973050019 4:45585208-45585230 ATGCTCCAGTGAAAAAAAAATGG + Intergenic
973099479 4:46246870-46246892 TCATTCCAATGAAAGAAGAAAGG - Intergenic
973178584 4:47240469-47240491 TTGATCCAATGCCAGAAAAGGGG + Intronic
973658313 4:53074812-53074834 TTGTTCCACTGACAGAACACAGG + Intronic
973881325 4:55274063-55274085 TTCTTCCAATGACAGAAAGCTGG - Intergenic
974212131 4:58791934-58791956 TTGTTCCATTTATAGAACAAAGG - Intergenic
974248218 4:59350279-59350301 TTGGTGAACTGAAAGAAAAAGGG + Intergenic
974467485 4:62275555-62275577 TTTTTCAAAGGAAGGAAAAATGG + Intergenic
974536012 4:63176654-63176676 TTGTACCAATGCAAAAAAACTGG - Intergenic
974571261 4:63651772-63651794 TTGCTCTTATGAAATAAAAAAGG + Intergenic
976396489 4:84561173-84561195 ATGTAAGAATGAAAGAAAAAAGG + Intergenic
977458240 4:97291042-97291064 TTATTCCAATGAAAGAAACCAGG - Intronic
977691576 4:99917684-99917706 TTTTTCAGATGAAGGAAAAATGG - Intronic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
978374818 4:108063817-108063839 TATTTTTAATGAAAGAAAAAAGG + Intronic
978421365 4:108536811-108536833 TTGTTGCAAGGAAATAACAATGG - Intergenic
979088795 4:116451382-116451404 TTGTTTCAAAAAAAAAAAAAAGG + Intergenic
979993046 4:127398402-127398424 TTGACCAAATAAAAGAAAAATGG - Intergenic
980664484 4:135912176-135912198 TTTTTTCCATGAAAGGAAAATGG - Intergenic
980715927 4:136629812-136629834 TTATTCAGATGATAGAAAAATGG - Intergenic
981256663 4:142669192-142669214 TTCTTCCAATCAAAGAACACAGG - Intronic
981553103 4:145961563-145961585 TTTTTCCACTACAAGAAAAAAGG - Intergenic
982424694 4:155244919-155244941 TTCTTTTAATGAGAGAAAAAGGG + Intergenic
982471355 4:155794336-155794358 TTGTTACAGTGAAAAAAAATGGG + Intronic
982485705 4:155963058-155963080 TAGTGTCAATGAAAGAAAATGGG - Intergenic
983054625 4:163086988-163087010 TTATCACAATGAAAGAATAAAGG - Intergenic
983249814 4:165330938-165330960 TTGGTTCAAAGAAAGATAAATGG + Intronic
983568804 4:169182846-169182868 TTCTTCCAACCAAAAAAAAAAGG + Intronic
983742871 4:171157324-171157346 TTGTTACAATGACAGAAAGGTGG + Intergenic
983794811 4:171848924-171848946 TTATTCAAATTAAAAAAAAAAGG - Intronic
984088382 4:175340242-175340264 TTGTTATAAGGAAAGAAAAGAGG - Intergenic
984527903 4:180879461-180879483 TTATCCTAATAAAAGAAAAACGG + Intergenic
984726397 4:183025767-183025789 TTGTTTCAAAAAAACAAAAAGGG + Intergenic
984839472 4:184054648-184054670 CTGTTCCAATGGAGGAAAAGGGG - Intergenic
984907348 4:184641068-184641090 TTGTACATATGAAAGAAAAAAGG - Intronic
984989232 4:185362199-185362221 TCTTTACAATGAAAAAAAAAAGG + Intronic
986079516 5:4375624-4375646 ATGTTCCCATGACAGAAAGAAGG - Intergenic
987466102 5:18273793-18273815 TTGTGCCAGTAAAAGAAAATGGG + Intergenic
987729645 5:21752501-21752523 GTGTTGCAACAAAAGAAAAAAGG + Intronic
987886503 5:23820310-23820332 TTTTTCCAGTAAAAGAAAATAGG + Intergenic
988075482 5:26348237-26348259 TTCTTCCAAACCAAGAAAAATGG - Intergenic
989191974 5:38679224-38679246 TGGTGCCAATGAAAATAAAATGG - Intergenic
989514179 5:42322473-42322495 GTGTTCAAATGAAAGGATAAAGG - Intergenic
989747001 5:44840607-44840629 TTGCAGCAATGAAGGAAAAAGGG - Intergenic
990059111 5:51625259-51625281 ATGTTCTTAAGAAAGAAAAAAGG - Intergenic
990459896 5:56021294-56021316 TTGTATCAAATAAAGAAAAATGG - Intergenic
990690261 5:58355789-58355811 TTGCTTCAATAAAAAAAAAAAGG - Intergenic
991332757 5:65510469-65510491 GTGCTCTAATGAATGAAAAATGG + Intergenic
991345432 5:65661067-65661089 GTGTTGCCATGAATGAAAAATGG + Intronic
991513423 5:67406306-67406328 TTATTAAAAAGAAAGAAAAAAGG - Intergenic
992012976 5:72548912-72548934 GTGCTCTAATGAAATAAAAATGG - Intergenic
992015073 5:72567233-72567255 TTGTTCCAATGAAATTAAATTGG + Intergenic
992101977 5:73416932-73416954 TCTTTCCAATGGAAAAAAAAAGG + Intergenic
992433017 5:76728056-76728078 TTTGTCAAATAAAAGAAAAAGGG - Intronic
992522684 5:77571898-77571920 TTTTTCCAATGGAAGAAATTGGG + Intronic
993048100 5:82892073-82892095 TTTCTGAAATGAAAGAAAAATGG - Intergenic
993302432 5:86227152-86227174 TTCCTCCAATAAAAGAATAAAGG + Intergenic
993620176 5:90158914-90158936 TTCTTCCAATACAAAAAAAAAGG + Intergenic
993838040 5:92838986-92839008 TTATTCCAATGTTAGCAAAAGGG - Intergenic
994030296 5:95133863-95133885 TTCTTCTACGGAAAGAAAAAAGG + Intronic
994519291 5:100810666-100810688 TTATTTTCATGAAAGAAAAATGG + Exonic
994579457 5:101620834-101620856 CTGTTTCATTGAAAAAAAAAAGG + Intergenic
994654915 5:102580602-102580624 TTGATCCAAGGATAGGAAAATGG - Intergenic
994995365 5:107055465-107055487 ATGTTCCAATTAAAAATAAAAGG + Intergenic
995499602 5:112790226-112790248 TTGTTAAAAAGAAAGAAAAGAGG + Intronic
995537860 5:113155372-113155394 TTGTTCAAAGCAAAGAAAATCGG - Intronic
995836144 5:116401458-116401480 TTGTACCATTAAAAAAAAAAAGG + Intronic
996534220 5:124559865-124559887 CTGTTCTAATGGATGAAAAATGG - Intergenic
996957662 5:129203987-129204009 TTTTTCCAAAAAAAAAAAAATGG - Intergenic
997135057 5:131316545-131316567 TTTGTCCAATGAGAGACAAAAGG + Intronic
997182069 5:131840291-131840313 AGGTTGAAATGAAAGAAAAAAGG - Intronic
997405777 5:133645480-133645502 TTTGTCGAATGAATGAAAAAAGG - Intergenic
997928556 5:138053336-138053358 ATGTTCCCAAGAAAGAAAGATGG + Intergenic
998120165 5:139569855-139569877 TTGTTTGAACAAAAGAAAAAAGG - Intronic
998610009 5:143678291-143678313 TTTTTCTAATGTAAGAAAACTGG + Intergenic
999058625 5:148609481-148609503 GTGTTCCAATACTAGAAAAATGG + Intronic
999309623 5:150543559-150543581 TTTTTAAAAAGAAAGAAAAAAGG - Intronic
999823443 5:155251344-155251366 GTGTTCCACTCAAAGCAAAATGG - Intergenic
1000074944 5:157776168-157776190 GTGATCAAATGAAACAAAAATGG - Intergenic
1000438192 5:161239340-161239362 TTATTCCAATTACATAAAAAAGG - Intergenic
1000647191 5:163773112-163773134 TTATTTTAATGAAAGAGAAAAGG + Intergenic
1001851937 5:174975517-174975539 CTACTCCAAAGAAAGAAAAATGG + Intergenic
1003488947 6:6604434-6604456 TTGTTGAAATGAAAAAATAATGG + Intronic
1003717184 6:8660045-8660067 TTTTTCCATTTAAAGAAAGAGGG + Intergenic
1003779045 6:9402640-9402662 ATGTTCCAATAAAAGCAATAAGG - Intergenic
1003984940 6:11426100-11426122 TTCTTCCCATTAGAGAAAAAGGG - Intergenic
1004122813 6:12841262-12841284 TTGGTCTAATGGAAGAAACAGGG - Intronic
1004299333 6:14443008-14443030 TTGTACCAATATAACAAAAAAGG - Intergenic
1004753290 6:18585220-18585242 TTGTTCCAATGACAGGAAGATGG - Intergenic
1005086600 6:22013747-22013769 TTATTCCAGGGAAAGAAAGAAGG + Intergenic
1005144260 6:22669516-22669538 TTGTTCCCATTAAAAGAAAATGG + Intergenic
1005145041 6:22679880-22679902 TTTTGCCAATGAAAGAACCAGGG + Intergenic
1005149573 6:22733617-22733639 TCATGCCAATGAAAGAACAAAGG + Intergenic
1005659801 6:27985320-27985342 TTTTTCCAGTGAAAGAGAACAGG + Intergenic
1006207099 6:32356713-32356735 CTGTCTCAATGAAAAAAAAAAGG + Intronic
1006572412 6:35016674-35016696 TTGATCCACTGAAAACAAAATGG - Intronic
1007882782 6:45185917-45185939 TTGTACCAATGAAGCCAAAAAGG + Intronic
1007991844 6:46264351-46264373 TTTTTCCCATGAAATTAAAATGG + Intronic
1008431467 6:51422583-51422605 TATTTCAAAAGAAAGAAAAAGGG + Intergenic
1008744704 6:54655940-54655962 TTATTTCAATGTAAAAAAAAAGG + Intergenic
1008812479 6:55520538-55520560 TTATTCCAATGAATAAAAAAGGG + Intronic
1008817131 6:55580900-55580922 TTGTTCCACTGCAAGTGAAATGG + Intergenic
1009571101 6:65386175-65386197 TTGATCCAAAAAAAAAAAAAAGG + Intronic
1009809176 6:68638951-68638973 TTTTTCCCATGAAAAAATAAAGG + Exonic
1009918873 6:70031235-70031257 TTGCTCAAATTAAAAAAAAAAGG - Intronic
1010118403 6:72342542-72342564 TTGGTAGAATCAAAGAAAAAAGG - Intronic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010796701 6:80124847-80124869 TTGTTTCATTGAAAGAGAACAGG + Intronic
1011130777 6:84050120-84050142 CTCCTCCAATTAAAGAAAAAAGG - Intronic
1011153695 6:84304479-84304501 TTGTTCCTATGTGTGAAAAAGGG + Intergenic
1011897192 6:92243370-92243392 TTTTTCCAATAAATGAACAATGG + Intergenic
1012172476 6:96035353-96035375 CTGTTCCAAGAAAAGAAACAGGG - Intronic
1012367396 6:98459014-98459036 TTGTTCCAGTGGGGGAAAAAAGG + Intergenic
1012368636 6:98475268-98475290 TTCTTCCAGTGAATGAACAAGGG - Intergenic
1012811433 6:103964435-103964457 TTGGTGCAATGATAGACAAATGG + Intergenic
1012988498 6:105900179-105900201 TTTTTCAAAGAAAAGAAAAATGG - Intergenic
1014146617 6:118005342-118005364 TGGTTTCATTGAAAGAAACAGGG - Intronic
1014368149 6:120571320-120571342 TAGTTCAAATGAAAGAAAATAGG + Intergenic
1014506294 6:122262724-122262746 TTTTTCCAATGCATGAAAATGGG + Intergenic
1015351229 6:132222358-132222380 TTCTTCCACTTAAAAAAAAATGG + Intergenic
1015758671 6:136633671-136633693 TTGTTCCAATCAAAAAGAAAAGG + Intronic
1015925531 6:138306799-138306821 GTGATCCATTAAAAGAAAAATGG + Intronic
1016051427 6:139534447-139534469 TTCTTCTGATGAAAGAAAAGTGG + Intergenic
1016231109 6:141805304-141805326 ATGTTCCAATGACAGAAAACAGG + Intergenic
1016387999 6:143547674-143547696 TTCTTCGAATGAAGGAAAAGGGG + Intronic
1016600096 6:145848723-145848745 TAATTCCAGTGAAAGATAAAGGG + Intergenic
1016615051 6:146038153-146038175 TTGTTAAAATGAAAGAAGAAAGG + Intronic
1017489807 6:154935020-154935042 TTGTTGGAATGTAGGAAAAAGGG + Intronic
1017562256 6:155640981-155641003 TAGGTGAAATGAAAGAAAAATGG + Intergenic
1017619617 6:156282688-156282710 TTGGGCCAGGGAAAGAAAAAAGG + Intergenic
1017641217 6:156496163-156496185 TTCTTCCATTTAAGGAAAAATGG - Intergenic
1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG + Intergenic
1018950073 6:168373326-168373348 TTCTTCAATTAAAAGAAAAAAGG - Intergenic
1019010159 6:168838626-168838648 TTGTTTCAATGCAAGCAATAGGG + Intergenic
1020539705 7:9444962-9444984 TTTTTCTAATGAAATAAATAAGG + Intergenic
1020607675 7:10358993-10359015 TGGTTACAATAAAAGAAAAAAGG - Intergenic
1020673403 7:11148552-11148574 TTGATACAGTGAAAGAAACAGGG - Intronic
1021000931 7:15329284-15329306 TTAATTCACTGAAAGAAAAAGGG - Intronic
1021633873 7:22672200-22672222 TTCTTCCAATGGAAAAAAATGGG + Intergenic
1021961475 7:25877416-25877438 TTAATTCAATGACAGAAAAAGGG - Intergenic
1022329961 7:29369091-29369113 TTTTTCAAATGAGAGAAAATAGG + Intronic
1022566730 7:31411055-31411077 TTGTTCCATTTAGAGAACAAGGG - Intergenic
1023754720 7:43405906-43405928 AATTGCCAATGAAAGAAAAAAGG - Intronic
1024123558 7:46269137-46269159 TTGTTTCAAAGAAAGTAAACTGG - Intergenic
1024175213 7:46833276-46833298 TTGTTCAAATGACCGAAAACTGG + Intergenic
1024668544 7:51569070-51569092 TTATTCTAATGCAATAAAAATGG + Intergenic
1025601324 7:63000537-63000559 TTGTTCGAAAGATGGAAAAAAGG - Intergenic
1025870285 7:65424974-65424996 TAGTTGAAATGAAAAAAAAAGGG + Intergenic
1025998678 7:66544505-66544527 ATGTCTCAAAGAAAGAAAAATGG + Intergenic
1026397136 7:69966994-69967016 TTGTACCAGAGAAAGAAAATTGG - Intronic
1026411600 7:70128591-70128613 GTGTTCGAGGGAAAGAAAAATGG + Intronic
1027763414 7:82308255-82308277 TTGACCCAATGGAAGAAATATGG - Intronic
1027874759 7:83754836-83754858 TTATTAAAATGAAATAAAAATGG - Intergenic
1028514787 7:91665305-91665327 TTTTTCCAATCAATGAAAATAGG - Intergenic
1028688738 7:93624756-93624778 TTCTTCAAATCAAAGAAACAAGG - Intronic
1028751186 7:94384724-94384746 TTGTCTCAAGAAAAGAAAAAAGG - Intergenic
1029133579 7:98352161-98352183 CTGTATCAATAAAAGAAAAATGG + Intronic
1029902869 7:104060494-104060516 ATGTTGAAATGAAGGAAAAAAGG + Intergenic
1030765218 7:113400796-113400818 TTGTTCCAAAGATGCAAAAATGG - Intergenic
1030929637 7:115506361-115506383 TTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1031205478 7:118751753-118751775 TTGTTTTTAAGAAAGAAAAAGGG - Intergenic
1031273820 7:119691734-119691756 ATGTTCAAATAAAAGTAAAAAGG - Intergenic
1032070672 7:128804516-128804538 TTTTTCTAAAGACAGAAAAAAGG - Intronic
1032981064 7:137283807-137283829 TTGTTAGAAGGAAAGAAAAGTGG - Intronic
1033073829 7:138229798-138229820 TAAGTCCAATGGAAGAAAAAAGG - Intergenic
1033709645 7:143928674-143928696 TAGTTCCATTGATAGAAATAAGG + Intergenic
1034824457 7:154248935-154248957 TTACTTCAAGGAAAGAAAAAGGG + Intronic
1034846292 7:154449281-154449303 TTTCTCCAAAGAAAGACAAATGG + Intronic
1035477881 7:159156495-159156517 TTCTTCCATTAAAAAAAAAATGG - Intergenic
1035696494 8:1601640-1601662 TTGTCACATTGAAAGTAAAATGG + Intronic
1035828662 8:2671456-2671478 TTGTAAAAATGAAACAAAAAAGG + Intergenic
1036238313 8:7061551-7061573 TTGCTACAGTTAAAGAAAAAAGG - Intergenic
1036514167 8:9428460-9428482 TTGTTTCTAGGAAAGAAAACTGG + Intergenic
1036987711 8:13555346-13555368 TATTTCAAATGGAAGAAAAATGG + Intergenic
1037051035 8:14374476-14374498 TTTTTCCAGTGAAATAAGAATGG + Intronic
1037746069 8:21645996-21646018 GTGTTCCAGGAAAAGAAAAAAGG + Intergenic
1038279513 8:26151262-26151284 TTGTACCAATGGAAAATAAAGGG - Intergenic
1038936490 8:32257394-32257416 ATTTTCCAATAAAAGAAATATGG - Intronic
1039766872 8:40637874-40637896 TCTTTCAAAAGAAAGAAAAATGG + Intronic
1041030969 8:53734826-53734848 TTATTCTAATGAAAAAAAAAAGG + Intronic
1041134206 8:54738603-54738625 GAGTTCCAATGACAGAAAGATGG - Intergenic
1041875807 8:62685532-62685554 TTGTTAAAAGGAAAGAATAAGGG - Intronic
1042629630 8:70802882-70802904 AAGTTGAAATGAAAGAAAAATGG - Intergenic
1042721455 8:71831176-71831198 AGAATCCAATGAAAGAAAAAAGG + Intronic
1043188027 8:77179956-77179978 TGGTTGGAATGAAAGAAAATGGG - Intergenic
1043210290 8:77505471-77505493 TTGTTTTAATGAAAGTGAAATGG + Intergenic
1043651155 8:82594266-82594288 TTGTGGAAATGAAAGTAAAAAGG + Intergenic
1043679450 8:83003880-83003902 TTCTTAAAATGGAAGAAAAAGGG + Intergenic
1044114783 8:88322150-88322172 TTGATCCAATTAAAATAAAAAGG + Intronic
1044323870 8:90838065-90838087 ATATTCCAATGAAAAAATAAGGG + Intronic
1044335237 8:90975485-90975507 TTTTTTTAAAGAAAGAAAAACGG + Intronic
1044484670 8:92737725-92737747 TTGTTCCAAAGAAAAAAACATGG - Intergenic
1044689757 8:94864992-94865014 TTGTTTCAACGAAAAAAATAAGG - Intronic
1045025905 8:98086419-98086441 GTGTTCAAAAGAGAGAAAAATGG + Intronic
1045305848 8:100956057-100956079 TTTTTTAAATGAAAGAAAAGGGG + Intergenic
1045454774 8:102367062-102367084 TTGCTCCAAAAAAAAAAAAATGG - Intronic
1045538525 8:103059054-103059076 TGCTTCCAATGACAGAGAAAAGG - Intronic
1046083236 8:109398011-109398033 TTCTTCAAATGAAAAAAAAAGGG - Intronic
1046147077 8:110174425-110174447 GTGTTCCCATCAAAAAAAAAAGG - Intergenic
1046167415 8:110454853-110454875 TTTCTCAAATGAAAGAGAAAAGG + Intergenic
1046209381 8:111047651-111047673 TTATTAAAAGGAAAGAAAAACGG + Intergenic
1046429014 8:114097545-114097567 TTTTTGCAATGAAAGGAACAAGG + Intergenic
1046678978 8:117146266-117146288 TTGTTTTAAAAAAAGAAAAAAGG + Intronic
1048495352 8:134930902-134930924 TTTCTCAAAAGAAAGAAAAAAGG + Intergenic
1049539006 8:143198046-143198068 TTCTTCCAATGAAACAAACAAGG + Intergenic
1049541098 8:143209365-143209387 TGGATCCCAGGAAAGAAAAAGGG + Intergenic
1050465543 9:5918964-5918986 TTGTTCCATTGAAAGAATACAGG - Intronic
1050777239 9:9280302-9280324 TTGTACATATGAAAGAAATAAGG + Intronic
1050967482 9:11824695-11824717 TTGTTCCATTTATAGAGAAAAGG - Intergenic
1051021644 9:12551822-12551844 TTGGCGAAATGAAAGAAAAATGG + Intergenic
1051034155 9:12722965-12722987 TGGTTTCAATGCAAGTAAAATGG + Intergenic
1052000256 9:23270066-23270088 TTGTTCAAAAAAGAGAAAAACGG + Intergenic
1052016329 9:23472827-23472849 TTGTACCTAGGTAAGAAAAAGGG + Intergenic
1052067008 9:24034491-24034513 GTGTTCCAGTGAAATAAAAATGG + Intergenic
1052123639 9:24749706-24749728 TTTTTTAAATGAAATAAAAATGG + Intergenic
1052763974 9:32621619-32621641 TTCTTACTATGAAAAAAAAAAGG + Intergenic
1052782077 9:32791861-32791883 ATTTTCCACTGAAAGAAGAATGG + Intergenic
1053627560 9:39890953-39890975 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1053778433 9:41575070-41575092 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1053911806 9:42914329-42914351 CTGTTTCAATGAAAAAAAAAGGG - Intergenic
1053942038 9:43260807-43260829 CTGTTTTTATGAAAGAAAAAAGG - Intergenic
1054216327 9:62359750-62359772 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054671154 9:67795593-67795615 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1054909436 9:70440621-70440643 TTGTGTCAAAGAAAAAAAAAAGG + Intergenic
1055027232 9:71735432-71735454 TTGATCCAAGCACAGAAAAATGG + Intronic
1055039364 9:71852296-71852318 TTGTTCCATTGATAGAACATAGG + Intergenic
1055147741 9:72956838-72956860 TTTTTCCAATTGAAGAAGAATGG - Intronic
1055543810 9:77345335-77345357 ATGCTTCAAAGAAAGAAAAATGG + Intronic
1055596389 9:77869303-77869325 TTTTTCCACTGAAATGAAAATGG - Intronic
1055904427 9:81276250-81276272 TTCTTCCCTTGAAAGACAAATGG - Intergenic
1056026944 9:82508214-82508236 TATTGCCAAAGAAAGAAAAAAGG + Intergenic
1056139974 9:83666732-83666754 ATATGCCATTGAAAGAAAAATGG + Intronic
1056439357 9:86604815-86604837 TTGTTGTAATGACAGAAGAAAGG - Intergenic
1056449135 9:86698346-86698368 ATTTTCCAACGAAAGAAACAAGG - Intergenic
1057773938 9:97990283-97990305 TTGTTTCAATGGCAGAAAAGTGG - Intronic
1058194234 9:101954093-101954115 CTGTCTCAAAGAAAGAAAAAAGG + Intergenic
1058482978 9:105415835-105415857 TTTTTCAAATGAACGTAAAACGG - Intronic
1059064274 9:111066284-111066306 AGGTTCCAAGGATAGAAAAAAGG - Intergenic
1059189703 9:112313035-112313057 CTGTTTCAAAGAAAAAAAAAAGG + Intronic
1061647305 9:132014777-132014799 TTGTTGAATTAAAAGAAAAAAGG + Intronic
1061697057 9:132384283-132384305 ATATTACAAAGAAAGAAAAATGG + Intronic
1186082737 X:5951305-5951327 TTGCTCAAATGTCAGAAAAATGG - Intronic
1186259719 X:7764357-7764379 TTGTTGCAATGAGGGAATAAAGG + Intergenic
1186268690 X:7860810-7860832 GTGTCCTAATGAAAGAAGAAAGG + Intergenic
1186382132 X:9071884-9071906 TTGTATGAATGAAAGAAACAAGG - Intronic
1186886994 X:13923749-13923771 TTGGTTGAAAGAAAGAAAAAAGG - Intronic
1186958357 X:14708008-14708030 GTGTTCTCATGAAAGAAAGAAGG - Intronic
1187203880 X:17162613-17162635 TTATAACAATTAAAGAAAAATGG + Intergenic
1187818837 X:23263472-23263494 TTTTTGAATTGAAAGAAAAAGGG - Intergenic
1190481985 X:50886370-50886392 TTGTTATAAGGAGAGAAAAATGG - Intergenic
1191058624 X:56270798-56270820 TTGTTCACATTAAAAAAAAAAGG + Intronic
1191174736 X:57486571-57486593 TTGTTAGAAACAAAGAAAAAGGG - Intronic
1192655494 X:72989040-72989062 TAGGTGCTATGAAAGAAAAAAGG + Intergenic
1192768234 X:74164260-74164282 TTTTTTAAATGAAAGAAAATTGG - Intergenic
1193379183 X:80798936-80798958 TTGTTACAATGAAACAATACAGG + Intronic
1193605201 X:83558917-83558939 TTGTCCCAATAATACAAAAATGG - Intergenic
1193622091 X:83766196-83766218 TTCTTCCAATCTATGAAAAAAGG + Intergenic
1194438399 X:93898051-93898073 TTGTTTCAATGAAATACAAGTGG + Intergenic
1194577597 X:95632784-95632806 ATGTTCCAAAGAAAGAGAAGAGG - Intergenic
1194613440 X:96072581-96072603 TTTTTCTAATGAAAGGAAATTGG + Intergenic
1194723289 X:97365492-97365514 GTATTCCAATCAGAGAAAAAGGG - Intronic
1195215722 X:102699607-102699629 TAGTTCACAGGAAAGAAAAAAGG + Intergenic
1195601108 X:106749898-106749920 TTGTTTCAAAAAAAAAAAAAAGG + Intronic
1196174724 X:112628115-112628137 CTTTTCCAATGAAAGGAAACTGG - Intergenic
1197054957 X:122106800-122106822 TTGATCCCATTAAAGTAAAAAGG + Intergenic
1197130277 X:122997551-122997573 TTATTCCAAAGAAAAAAACATGG + Intergenic
1197163970 X:123355717-123355739 TTGTGCTAATGAAACAAAATTGG - Intronic
1197426427 X:126302520-126302542 TGGTTTGAGTGAAAGAAAAAAGG - Intergenic
1197794182 X:130282895-130282917 TGCTTCAAATGCAAGAAAAATGG + Intergenic
1197804933 X:130389778-130389800 TTGTCCCAAAAAAAAAAAAAGGG - Intergenic
1197903857 X:131402394-131402416 TTCTTCCAATAACAGATAAAAGG + Intergenic
1197915595 X:131530871-131530893 CTGTTCTCATGAAAGAAAAGGGG - Intergenic
1198225754 X:134644406-134644428 TGGTACCATTGACAGAAAAATGG - Intronic
1198513814 X:137383681-137383703 TTTTTCCAATCAACGAAAATGGG - Intergenic
1198762888 X:140052031-140052053 TTGTTTTACTGAGAGAAAAATGG - Intergenic
1198810937 X:140535659-140535681 TAGTTAGAATGAAAGAACAAAGG - Intergenic
1199239585 X:145530577-145530599 TTGTTGAAAAGAAAGAAGAATGG + Intergenic
1199476061 X:148246594-148246616 TTCTTCCCCTGAAAGAAAGAGGG - Intergenic
1199838628 X:151620439-151620461 TTGTTTCAGTGAAAAAAAAATGG - Intronic
1199929180 X:152501236-152501258 CTGTTTCAATGTAAGCAAAATGG - Intergenic
1201456203 Y:14169519-14169541 TTGTTGCAATGAGGGAATAAAGG - Intergenic
1201512554 Y:14781026-14781048 TTGCTCAAATGTCAGAAAAATGG + Intronic
1201583386 Y:15534539-15534561 TAGTTCCAATGATAGCATAAGGG - Intergenic