ID: 977761117

View in Genome Browser
Species Human (GRCh38)
Location 4:100738493-100738515
Sequence CACTCTCCCCAAAGGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977761117 Original CRISPR CACTCTCCCCAAAGGCAGGT TGG (reversed) Intronic
900114734 1:1023649-1023671 CACTAACCCCACAGCCAGGTGGG + Intronic
900491298 1:2950430-2950452 CAGTTTCCCCAAATGCAGGTGGG + Intergenic
902129668 1:14248731-14248753 CACTCTTCCCATGGACAGGTGGG + Intergenic
904932418 1:34099873-34099895 CAATTTCAGCAAAGGCAGGTGGG + Intronic
905801747 1:40848582-40848604 CACTCTCCCCAAAGCAAGGCTGG + Intergenic
906407064 1:45550628-45550650 TACTCTCCCTAAAGTCAGGTTGG - Exonic
906640467 1:47438052-47438074 CACTCGCCCCAGAGGCAGCGCGG + Exonic
907443277 1:54491199-54491221 CAGTCTCCCCAAAGCCGGGCAGG - Intergenic
910636118 1:89409959-89409981 CACACTTCACAAAAGCAGGTGGG - Intergenic
910865284 1:91782792-91782814 CCCTCTCCCCCAAGGCACCTCGG + Intronic
912382489 1:109254960-109254982 CACGCTCACCAAAGGCAGGCTGG - Intronic
912546654 1:110456189-110456211 CACCTTCACCAAAGGGAGGTAGG - Intronic
913042256 1:115038663-115038685 CACTCTCCCCAAAGGTGAGCGGG + Intergenic
913201626 1:116499258-116499280 CACTGTCCCTAAAAGCAGCTCGG + Intergenic
916069119 1:161159753-161159775 CACTCTCCACAAAGGCGCGTGGG + Intronic
920708262 1:208271112-208271134 CTCTCTCCACAAAGGTGGGTTGG - Intergenic
920804024 1:209216377-209216399 CACTCTCTCCAGTGGCAGGGAGG + Intergenic
921604884 1:217140458-217140480 CACTCAGGCCCAAGGCAGGTTGG - Intergenic
922479820 1:225931886-225931908 CGCTCTCCCCAAAGACACCTGGG - Intergenic
923017417 1:230137451-230137473 CCCTCTCAGCAAAGCCAGGTGGG - Intronic
923425001 1:233859987-233860009 CGCTCTCCCCAAAGGCACATAGG + Intergenic
923779453 1:237009160-237009182 CAGTCTCCCCAAAGGCCTGGAGG - Intergenic
1062802658 10:391544-391566 CCAGCTGCCCAAAGGCAGGTGGG + Intronic
1063151992 10:3345519-3345541 CACCCTCCCCACAGGCAGGCTGG - Intergenic
1064621691 10:17224098-17224120 TAATCTCCCTAAGGGCAGGTAGG - Intergenic
1067066318 10:43106026-43106048 CACTCTCCCCTGAGGAAGCTGGG - Intronic
1068192279 10:53667442-53667464 CAGTCTCCACAAAGACAGGGTGG - Intergenic
1069899283 10:71697695-71697717 GACACTCCCCAAAGGCAGGCAGG - Intronic
1069997881 10:72354228-72354250 CACTCTCCCAAAATGCAAGCCGG - Intronic
1070510555 10:77156956-77156978 CAGTCTCCCCAAAGGCTAGGAGG - Intronic
1072098381 10:92205240-92205262 TCCTCTCCCCAGAGGCAGATTGG - Intronic
1073181246 10:101584813-101584835 CAATCTCCCTCAAGGGAGGTGGG + Exonic
1074441160 10:113478561-113478583 CCCTCTCCCCAAATCCAGCTGGG + Intergenic
1074863842 10:117533660-117533682 CATCCACCCCAAAGGCACGTGGG - Intergenic
1075742030 10:124701784-124701806 CCATCTCCCCCCAGGCAGGTGGG + Intronic
1076903267 10:133350263-133350285 CTCTCTCCCCTAAGCCAGCTTGG - Intronic
1078276566 11:9853982-9854004 CACTCTCCCAAAAGGAATGCAGG + Intronic
1078932854 11:15926261-15926283 CACTCTCCCTCAATGCACGTGGG + Intergenic
1079074908 11:17378642-17378664 CACTTTCCCCAACAGCAGTTGGG + Intergenic
1081687944 11:45055691-45055713 CCCTCTCCCCACTGACAGGTGGG + Intergenic
1084179782 11:67440535-67440557 CACTGCCCCTAAATGCAGGTGGG + Intronic
1084270331 11:68026085-68026107 CACTCCTCCAAAAGGCAGGCTGG - Exonic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085503857 11:77044571-77044593 CATTCACCCCAAAAGCATGTAGG - Intergenic
1085560647 11:77470534-77470556 CACTCTCCCAGAAGGAAGCTAGG + Intronic
1088741182 11:112768572-112768594 AACTCTGGCCCAAGGCAGGTAGG - Intergenic
1089114806 11:116086136-116086158 CCCTATCCCAAAAGGCAGGGAGG - Intergenic
1089759426 11:120712183-120712205 CACTACCCCCAAGGGCAGGCTGG - Intronic
1091523266 12:1269714-1269736 CACTTTCCCAAAAGGCACATGGG + Intronic
1095950812 12:47781005-47781027 CTCTCTTCCCAAGGCCAGGTTGG + Exonic
1096658459 12:53106079-53106101 CTCTTGCCCCAAGGGCAGGTGGG - Intronic
1099905773 12:88768138-88768160 CTCTCTCCCCTCAGGCATGTAGG + Intergenic
1101598447 12:106188377-106188399 CTCTCTCCCCTCAGGCAGGGCGG - Intergenic
1102321256 12:111936657-111936679 ATCTCTCCACAAAGGAAGGTAGG + Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1106242531 13:27922452-27922474 CGCTCTTCCCAGGGGCAGGTGGG - Intronic
1110713233 13:78672930-78672952 CTCTCTCCCCCAAGCCAGGGTGG + Intergenic
1112422419 13:99264629-99264651 CACTCTCCCCAGGGGCAGTTGGG + Intronic
1117097334 14:52312281-52312303 CTCTCTCCCCAAAGCCACCTTGG - Intergenic
1118128636 14:62937492-62937514 GACTCTCCCCTTAGGAAGGTGGG - Intronic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1122168016 14:99845119-99845141 CACTCTCCCCCACTGCTGGTGGG - Intronic
1124422598 15:29535942-29535964 AACATTCCCCAAAGGCAGGGAGG + Intronic
1127829467 15:62737707-62737729 CACTCTGCCCAAGGGCAAGTGGG - Intronic
1127831106 15:62752355-62752377 CACATTCCCCAAAGGCAGGGAGG - Exonic
1129614944 15:77091008-77091030 CACTTTCCCCAAAGGCCAGATGG - Intergenic
1130274772 15:82470643-82470665 ACCTCTCCCCAAAGGCAGAATGG + Intergenic
1130467117 15:84198017-84198039 ACCTCTCCCCAAAGGCAGAATGG + Intergenic
1130486488 15:84401160-84401182 ACCTCTCCCCAAAGGCAGAACGG - Intergenic
1130497147 15:84475519-84475541 ACCTCTCCCCAAAGGCAGAATGG - Intergenic
1130589416 15:85202610-85202632 ACCTCTCCCCAAAGGCAGAATGG + Intergenic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1131511437 15:93051468-93051490 CATCCTCCCCAAAAGCAGGTAGG + Intronic
1132468313 16:88088-88110 CACTGTCCCCCAAGTCAGGGTGG + Intronic
1135705183 16:24668876-24668898 CACTCTGTTCAAAGGGAGGTTGG - Intergenic
1137587616 16:49673222-49673244 CACTCCTCCCAAAGGCATCTGGG - Intronic
1138138014 16:54540620-54540642 AACATTCCCCAAAGACAGGTTGG + Intergenic
1138554344 16:57763119-57763141 CTGTCTCCCCACAGCCAGGTTGG + Intronic
1139559075 16:67730277-67730299 CTCTCAGCCCAAAGGCAGGAGGG + Intronic
1139571334 16:67814566-67814588 CCTTCTCCCCAAAGCCTGGTGGG - Intronic
1140410292 16:74737123-74737145 CCCCCTCCCCAAAGGGAGGCTGG + Intronic
1141564543 16:84892402-84892424 CACTCTCCCCCAGGCCAGGCTGG - Intronic
1141572440 16:84942038-84942060 CACTCAGCCCAAGGGCAGATGGG - Intergenic
1141593027 16:85081270-85081292 CACTCTCTCCAAGGGGAGGCGGG - Intronic
1141761769 16:86033315-86033337 CACTCTCCCCAGAGCCCGTTTGG + Intergenic
1144577393 17:16437605-16437627 CACTCTCCCCAAATTCATGCAGG + Intergenic
1149800891 17:59566105-59566127 TACTGTACCCAAAGGCAGGCTGG - Intronic
1151273523 17:73015266-73015288 CAGTATTCCCAAAGGCAGGGAGG - Intronic
1151504328 17:74516617-74516639 CACCCTCTCCTGAGGCAGGTTGG - Intergenic
1151802679 17:76387063-76387085 CACTCTTCCTACAGGGAGGTAGG - Exonic
1151876688 17:76870933-76870955 CAATGTCCCCCAAGGCAGCTGGG - Intronic
1155958691 18:31975681-31975703 CACTCTTCCCCAATGAAGGTGGG + Intergenic
1157049336 18:44142753-44142775 CAGTCTCCACAAAGGAATGTAGG + Intergenic
1157618658 18:49002807-49002829 CATTCTTCACAAAGGCATGTGGG - Intergenic
1157979308 18:52362715-52362737 TAATCTCCCTATAGGCAGGTTGG + Intronic
1159775637 18:72600738-72600760 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1160012177 18:75114452-75114474 CACTCTCCCCACAGCCAGAGTGG + Intergenic
1160792253 19:928173-928195 CACCCTCCCGAGAGGCAGCTGGG - Intronic
1161566640 19:5006232-5006254 CACACTACCCAGAGGCAGGGTGG - Intronic
1164565746 19:29324619-29324641 CACTCTCCCCACAGCCAGGTGGG + Intergenic
1164931829 19:32181836-32181858 CGCTATTCCCAAAGCCAGGTGGG + Intergenic
1167345779 19:48944810-48944832 CACTCTCCCCACAGGTATGAAGG + Exonic
925105101 2:1284014-1284036 CATTCTTCACAACGGCAGGTCGG - Intronic
926059070 2:9794011-9794033 CACTCTCCTCACAGGCAGTCAGG + Intergenic
926278240 2:11422615-11422637 GATTCTGCCCAAGGGCAGGTCGG - Intergenic
927957642 2:27218885-27218907 CACTCTCCCCAGCGTCAGGGTGG - Intronic
928265051 2:29804250-29804272 CACTGGCCCCACAGACAGGTGGG + Intronic
929847745 2:45548851-45548873 CACCCTCCAAAAAAGCAGGTGGG + Intronic
930192846 2:48478142-48478164 CACTCTCCCCAAAGGCCCTAAGG - Intronic
931412332 2:62045087-62045109 CAGTCTCCCCAAAGGCCTGCAGG + Intronic
932438973 2:71719789-71719811 CACACTGCCCATAGGCAAGTCGG + Intergenic
934489678 2:94752853-94752875 CTCCCTCCCCAATGGCATGTAGG + Intergenic
937260122 2:120580083-120580105 CGCTGTCCCCAGAGGAAGGTGGG + Intergenic
937914177 2:127090754-127090776 CACTTGGCCCCAAGGCAGGTGGG - Intronic
938240154 2:129737232-129737254 CTCTTCACCCAAAGGCAGGTGGG + Intergenic
938797973 2:134734704-134734726 CACTCTCCCCATGCCCAGGTGGG + Intergenic
942578705 2:177393182-177393204 CACTCTCTCGAAAGAGAGGTGGG - Intronic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
1169017978 20:2307222-2307244 CCCTCTCTCCAGTGGCAGGTTGG + Intronic
1172233107 20:33350408-33350430 CCCTCTCCCCAAGTACAGGTGGG + Intergenic
1173591909 20:44231433-44231455 CAGCCTCCCCAAAGGCAGGGAGG - Intergenic
1173870647 20:46339888-46339910 CACTTTCCCCAAAAGCATTTTGG + Intergenic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1175774616 20:61645205-61645227 CACTGTTCCAAAAGGCAGATGGG - Intronic
1176421605 21:6520456-6520478 TCCACTCCTCAAAGGCAGGTTGG - Intergenic
1176840725 21:13841027-13841049 CTCACTCCCCAATGGCATGTTGG + Intergenic
1178298290 21:31429309-31429331 TACTTTCCACAAAGGTAGGTTGG - Intronic
1179571142 21:42279548-42279570 CACTGCCCCAAAAGGCAGGTGGG - Intronic
1179697095 21:43128772-43128794 TCCACTCCTCAAAGGCAGGTTGG - Intergenic
1182133634 22:27879478-27879500 CACTCTCCTCAGGGGGAGGTGGG + Intronic
949300953 3:2583313-2583335 CACCCTCCCCCAAGATAGGTTGG - Intronic
950119056 3:10469834-10469856 CCCTCTCCCCAAAGGCTGGAGGG - Intronic
954375575 3:50192564-50192586 CACTTTCCCCCAAGGCAGAGAGG + Intronic
954645683 3:52130275-52130297 CACTCACCCCAGAGGCCTGTTGG - Intronic
954685671 3:52368942-52368964 CACTCTCCTCCAAGGCTGGGTGG + Intronic
954843697 3:53535305-53535327 CCCCCTCCCCAAAGGGATGTAGG + Intronic
955044234 3:55344690-55344712 CACACACCCCCAAGGGAGGTAGG - Intergenic
956256724 3:67291103-67291125 GACTCTCCCAGAAGGCTGGTAGG + Intergenic
960623841 3:119661164-119661186 GGCTCTCCCCAAAGGGAGCTCGG - Intronic
960639434 3:119812049-119812071 CTCTCTCCTTTAAGGCAGGTAGG + Intronic
964970275 3:162551915-162551937 GAATCTCCCCAAAGGTAGTTCGG + Intergenic
965837098 3:172864781-172864803 TTCTCTCCTCAAAGGGAGGTTGG - Intergenic
969601245 4:8177765-8177787 CACCCTCCCCAAAGCCAGCTTGG - Intergenic
970147039 4:13046848-13046870 AGCTCTCACCAATGGCAGGTGGG + Intergenic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
971140671 4:23921598-23921620 CTCACACCCCACAGGCAGGTGGG + Intergenic
976862416 4:89681401-89681423 CACTCTCCCGGTACGCAGGTGGG - Intergenic
977741664 4:100491501-100491523 AAGGCTCCCCATAGGCAGGTGGG + Intronic
977761117 4:100738493-100738515 CACTCTCCCCAAAGGCAGGTTGG - Intronic
977847299 4:101780987-101781009 CACTCAACCCAAAGGCAAGGGGG - Intronic
980819426 4:137994387-137994409 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
980829178 4:138108851-138108873 CAATCTCCCCAAAGGCTTGGAGG - Intergenic
981306988 4:143256854-143256876 CACTCTCCTCATAGGCATTTGGG - Intergenic
1202767071 4_GL000008v2_random:156307-156329 CACTCACCCCAAAGGCACTCTGG + Intergenic
988337464 5:29925219-29925241 TAATCTCCCCAAAGCTAGGTAGG + Intergenic
990170081 5:53038415-53038437 CACTGTTCTCAATGGCAGGTAGG - Intronic
997286461 5:132682242-132682264 CACCCACCCCAAAAGCAGATAGG + Intronic
997884146 5:137615535-137615557 CCCCCTCCCCAGAGGCAGGTAGG + Intergenic
998134580 5:139668081-139668103 CACCCTCCCCAACCTCAGGTAGG + Intronic
998514139 5:142737471-142737493 CAAACTCCCCCAAGGCAGGAAGG + Intergenic
999976063 5:156913257-156913279 CAATCTCCCCAAAGGCTTGAAGG - Intergenic
1000017800 5:157293807-157293829 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1000337438 5:160252297-160252319 CCCACTCCCCAAATACAGGTGGG + Exonic
1000740879 5:164968837-164968859 CACTTTCCCCAACAGCAGTTGGG - Intergenic
1001281799 5:170391354-170391376 CATTCTTCCCAAGGGAAGGTGGG + Intronic
1002131089 5:177082122-177082144 GACTCTGCCCCCAGGCAGGTGGG + Intergenic
1003819448 6:9879285-9879307 CACTCTTCCCAAAGGCTTATAGG - Intronic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1007810155 6:44479947-44479969 CACTCACCCCACAAGCAGGGTGG + Intergenic
1009350552 6:62671626-62671648 CACTCTCCCCAAATGTCGATGGG - Intergenic
1011900146 6:92284249-92284271 CACGGGCCCCAAAGGCAGCTGGG - Intergenic
1012535440 6:100291360-100291382 TATTCTCTCCAAAGGCAAGTGGG + Intergenic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1016383434 6:143508657-143508679 AACCCTGCCCAAAGGCAGGAAGG - Intronic
1016603703 6:145892859-145892881 CATTCTCCTCAAAGGCATGATGG + Intronic
1017999903 6:159569847-159569869 TACTCTCCCCAAGGTCAGGCTGG + Intergenic
1019443916 7:1061121-1061143 TATCCTCCCCAAAGGCAGGAGGG + Intronic
1024858944 7:53815287-53815309 CAATCTCTCCATAGGCAGGAAGG - Intergenic
1026972462 7:74476710-74476732 CACTGGCCCCAAAGGCTGGGTGG - Intronic
1029133522 7:98351548-98351570 CATTGTCTCCAAAGGCAGGAAGG - Intronic
1032540312 7:132697494-132697516 CTTTTTCCCCAGAGGCAGGTAGG + Intronic
1034462366 7:151205008-151205030 CACTCTCCCTAAGACCAGGTCGG - Intronic
1037469758 8:19195848-19195870 CACTGTCCCGAAAGGCTGGCAGG + Intergenic
1037553366 8:19996904-19996926 CACTTTTCCCAAAGGCAAGATGG + Intergenic
1038704369 8:29880177-29880199 CACTCTCCACCAGGGCAGGAAGG + Intergenic
1038794793 8:30700422-30700444 CTCCCACCCCAAGGGCAGGTAGG + Intronic
1038916601 8:32031270-32031292 CTCTCTTTCCAAAGGTAGGTAGG + Intronic
1039376942 8:37044287-37044309 TCCTCTCCCCAAAGGGAGGCTGG - Intergenic
1040855900 8:51947783-51947805 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
1041279596 8:56197199-56197221 CTCTCTCCCCAAATCCTGGTGGG + Intronic
1045458720 8:102408269-102408291 CACTCTCCTCAAGGTCAGGGAGG - Intronic
1046601774 8:116325490-116325512 CATTCTACCCAAAGACATGTGGG - Intergenic
1048325876 8:133438368-133438390 CATTCTCCCCAAAAGCAGTAAGG + Intergenic
1048624829 8:136173591-136173613 CACTCTTACCACAGGCATGTAGG + Intergenic
1049079129 8:140427965-140427987 CAGTCTCCCCATAGGCAGGGAGG - Intronic
1049321433 8:141998967-141998989 CACTCTCTCCAAAGGCTTGAGGG + Intergenic
1049384466 8:142334416-142334438 CACTCTCCCCATTCACAGGTGGG + Intronic
1055760178 9:79598714-79598736 CTCTCTCCCCAAAGCCAGAAGGG + Intronic
1056173320 9:84009364-84009386 CACTCAACCCAGAGGAAGGTAGG + Intergenic
1058831149 9:108817857-108817879 TATTCTATCCAAAGGCAGGTGGG + Intergenic
1059535147 9:115073738-115073760 CAGTCTCCCCACAGGCCAGTGGG - Exonic
1061206576 9:129167329-129167351 CAGTCTCCTCAAAGGAAGCTGGG - Intergenic
1062385019 9:136305845-136305867 CGCTGTCCCCCAGGGCAGGTGGG - Intronic
1062589361 9:137266557-137266579 CATTTTCCCAAAAGGAAGGTGGG - Intronic
1187441903 X:19328256-19328278 CACGTTCAGCAAAGGCAGGTTGG - Intergenic
1191924750 X:66297424-66297446 CAATCTCCCCAAAAGCAGTTGGG - Intergenic
1198319889 X:135510316-135510338 CACTCTTCCCACTGGGAGGTGGG - Intergenic
1199396255 X:147342115-147342137 CACTCTTCCTTAAGGAAGGTGGG - Intergenic
1201321308 Y:12700912-12700934 CCCCCTTCCCAAAGGCAGGAAGG + Intergenic
1202369020 Y:24185011-24185033 ACCTCTCCCCAAAGGCAGAACGG - Intergenic
1202501765 Y:25485106-25485128 ACCTCTCCCCAAAGGCAGAACGG + Intergenic